| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407054 |
Name | MIR98 |
Synonym | MIRN98|hsa-mir-98|miR-98;microRNA 98;MIR98;microRNA 98 |
Definition | - |
Position | Xp11.22 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407054 |
Links to all GeneRIF Items | 407054 |
Links to iHOP | 407054 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407054 : length: 22 tgaggtagtaagttgtattgtt |
Protein Sequence |
>407054 : length: 3 N/A |