| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407055 |
Name | MIR99A |
Synonym | MIRN99A;microRNA 99a;MIR99A;microRNA 99a |
Definition | hsa-mir-99a |
Position | 21q21.1 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 407055 |
Links to all GeneRIF Items | 407055 |
Links to iHOP | 407055 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >407055 : length: 22 aacccgtagatccgatcttgtg |
Protein Sequence | >407055 : length: 3 N/A |