| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 442892 |
Name | MIR148B |
Synonym | MIRN148B|mir-148b;microRNA 148b;MIR148B;microRNA 148b |
Definition | hsa-mir-148b |
Position | 12q13.13 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 442892 |
Links to all GeneRIF Items | 442892 |
Links to iHOP | 442892 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>442892 : length: 22 aagttctgttatacactcaggc |
Protein Sequence |
>442892 : length: 3 N/A |