| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 442900 |
Name | MIR326 |
Synonym | MIRN326|hsa-mir-326;microRNA 326;MIR326;microRNA 326 |
Definition | - |
Position | 11q13.4 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 442900 |
Links to all GeneRIF Items | 442900 |
Links to iHOP | 442900 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >442900 : length: 20 cctctgggcccttcctccag |
Protein Sequence | >442900 : length: 3 N/A |