| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 442915 |
Name | MIR370 |
Synonym | MIRN370|hsa-mir-370;microRNA 370;MIR370;microRNA 370 |
Definition | - |
Position | 14q32.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 442915 |
Links to all GeneRIF Items | 442915 |
Links to iHOP | 442915 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>442915 : length: 22 gcctgctggggtggaacctggt |
Protein Sequence |
>442915 : length: 3 N/A |