| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 442920 |
Name | MIR196B |
Synonym | MIRN196B|miR-196b|miRNA196B;microRNA 196b;MIR196B;microRNA 196b |
Definition | hsa-mir-196b |
Position | 7p15.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 442920 |
Links to all GeneRIF Items | 442920 |
Links to iHOP | 442920 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>442920 : length: 22 taggtagtttcctgttgttggg |
Protein Sequence |
>442920 : length: 3 N/A |