| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 494327 |
Name | MIR378A |
Synonym | MIR378|MIRN378|hsa-mir-378|hsa-mir-378a|miRNA378;microRNA 378a;MIR378A;microRNA 378a |
Definition | microRNA 378 |
Position | 5q32 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 494327 |
Links to all GeneRIF Items | 494327 |
Links to iHOP | 494327 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>494327 : length: 22 ctcctgactccaggtcctgtgt |
Protein Sequence |
>494327 : length: 3 N/A |