| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 554213 |
Name | MIR449A |
Synonym | MIRN449|MIRN449A|hsa-mir-449;microRNA 449a;MIR449A;microRNA 449a |
Definition | hsa-mir-449a|microRNA 449 |
Position | 5q11.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 554213 |
Links to all GeneRIF Items | 554213 |
Links to iHOP | 554213 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>554213 : length: 22 tggcagtgtattgttagctggt |
Protein Sequence |
>554213 : length: 3 N/A |