| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 574033 |
Name | MIR18B |
Synonym | MIRN18B|hsa-mir-18b;microRNA 18b;MIR18B;microRNA 18b |
Definition | - |
Position | Xq26.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
|
External Links |
|
Links to Entrez Gene | 574033 |
Links to all GeneRIF Items | 574033 |
Links to iHOP | 574033 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>574033 : length: 23 taaggtgcatctagtgcagttag |
Protein Sequence |
>574033 : length: 3 N/A |