| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 574411 |
Name | MIR451A |
Synonym | MIR451|MIRN451|hsa-mir-451|hsa-mir-451a;microRNA 451a;MIR451A;microRNA 451a |
Definition | microRNA 451 |
Position | 17q11.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 574411 |
Links to all GeneRIF Items | 574411 |
Links to iHOP | 574411 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>574411 : length: 22 aaaccgttaccattactgagtt |
Protein Sequence |
>574411 : length: 3 N/A |