| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 574445 |
Name | MIR511 |
Synonym | MIR511-1|MIR511-2|MIRN511-1|MIRN511-2|hsa-mir-511|hsa-mir-511-2;microRNA 511;MIR511;microRNA 511 |
Definition | hsa-mir-511-1|microRNA 511-1|microRNA 511-2 |
Position | 10p12.33 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 574445 |
Links to all GeneRIF Items | 574445 |
Links to iHOP | 574445 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>574445 : length: 21 gtgtcttttgctctgcagtca |
Protein Sequence |
>574445 : length: 3 N/A |