| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 574450 |
Name | MIR493 |
Synonym | MIRN493|hsa-mir-493;microRNA 493;MIR493;microRNA 493 |
Definition | - |
Position | 14q32.2 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 574450 |
Links to all GeneRIF Items | 574450 |
Links to iHOP | 574450 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >574450 : length: 22 ttgtacatggtaggctttcatt |
Protein Sequence | >574450 : length: 3 N/A |