| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 574456 |
Name | MIR497 |
Synonym | MIRN497|hsa-mir-497;microRNA 497;MIR497;microRNA 497 |
Definition | - |
Position | 17p13.1 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 574456 |
Links to all GeneRIF Items | 574456 |
Links to iHOP | 574456 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >574456 : length: 21 cagcagcacactgtggtttgt |
Protein Sequence | >574456 : length: 3 N/A |