| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 574473 |
Name | MIR520B |
Synonym | MIRN520B;microRNA 520b;MIR520B;microRNA 520b |
Definition | hsa-mir-520b |
Position | - |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 574473 |
Links to all GeneRIF Items | 574473 |
Links to iHOP | 574473 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>574473 : length: 21 aaagtgcttccttttagaggg |
Protein Sequence |
>574473 : length: 3 N/A |