| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 574476 |
Name | MIR520C |
Synonym | MIRN520C;microRNA 520c;MIR520C;microRNA 520c |
Definition | hsa-mir-520c |
Position | 19q13.42 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 574476 |
Links to all GeneRIF Items | 574476 |
Links to iHOP | 574476 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >574476 : length: 22 ctctagagggaagcactttctg |
Protein Sequence | >574476 : length: 3 N/A |