General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 619552 |
Name | MIR483 |
Synonym | MIRN483|hsa-mir-483;microRNA 483;MIR483;microRNA 483 |
Definition | - |
Position | 11p15.5 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
External Links |
|
Links to Entrez Gene | 619552 |
Links to all GeneRIF Items | 619552 |
Links to iHOP | 619552 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>619552 : length: 22 aagacgggaggaaagaagggag |
Protein Sequence |
>619552 : length: 3 N/A |