| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 693159 |
Name | MIR574 |
Synonym | MIR574-3p|MIRN574|hsa-mir-574;microRNA 574;MIR574;microRNA 574 |
Definition | - |
Position | - |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 693159 |
Links to all GeneRIF Items | 693159 |
Links to iHOP | 693159 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>693159 : length: 23 tgagtgtgtgtgtgtgagtgtgt |
Protein Sequence |
>693159 : length: 3 N/A |