CleftGeneDB-Search

Gene: EXT1

Basic information

Tag	Content
Uniprot ID	Q16394; B2R7V2; Q9BVI9;
Entrez ID	2131
Genbank protein ID	AAC51154.1; AAH01174.1; EAW91972.1; AAB62283.1; BAG35949.1;
Genbank nucleotide ID	NM_000127.2
Ensembl protein ID	ENSP00000367446
Ensembl nucleotide ID	ENSG00000182197
Gene name	Exostosin-1
Gene symbol	EXT1
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Glycosyltransferase required for the biosynthesis of heparan-sulfate. The EXT1/EXT2 complex possesses substantially higher glycosyltransferase activity than EXT1 or EXT2 alone. Appears to be a tumor suppressor. Required for the exosomal release of SDCBP, CD63 and syndecan (PubMed:22660413).
Sequence	MQAKKRYFIL LSAGSCLALL FYFGGLQFRA SRSHSRREEH SGRNGLHHPS PDHFWPRFPD 60 ALRPFVPWDQ LENEDSSVHI SPRQKRDANS SIYKGKKCRM ESCFDFTLCK KNGFKVYVYP 120 QQKGEKIAES YQNILAAIEG SRFYTSDPSQ ACLFVLSLDT LDRDQLSPQY VHNLRSKVQS 180 LHLWNNGRNH LIFNLYSGTW PDYTEDVGFD IGQAMLAKAS ISTENFRPNF DVSIPLFSKD 240 HPRTGGERGF LKFNTIPPLR KYMLVFKGKR YLTGIGSDTR NALYHVHNGE DVVLLTTCKH 300 GKDWQKHKDS RCDRDNTEYE KYDYREMLHN ATFCLVPRGR RLGSFRFLEA LQAACVPVML 360 SNGWELPFSE VINWNQAAVI GDERLLLQIP STIRSIHQDK ILALRQQTQF LWEAYFSSVE 420 KIVLTTLEII QDRIFKHISR NSLIWNKHPG GLFVLPQYSS YLGDFPYYYA NLGLKPPSKF 480 TAVIHAVTPL VSQSQPVLKL LVAAAKSQYC AQIIVLWNCD KPLPAKHRWP ATAVPVVVIE 540 GESKVMSSRF LPYDNIITDA VLSLDEDTVL STTEVDFAFT VWQSFPERIV GYPARSHFWD 600 NSKERWGYTS KWTNDYSMVL TGAAIYHKYY HYLYSHYLPA SLKNMVDQLA NCEDILMNFL 660 VSAVTKLPPI KVTQKKQYKE TMMGQTSRAS RWADPDHFAQ RQSCMNTFAS WFGYMPLIHS 720 QMRLDPVLFK DQVSILRKKY RDIERL 746

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	EXT1	538602	A5D7I4		Bos taurus	Prediction	More>>
1:1 ortholog	EXT1	482024	E2QRR1		Canis lupus familiaris	Prediction	More>>
1:1 ortholog	EXT1	100056983	F6TQG8		Equus caballus	Prediction	More>>
1:1 ortholog	EXT1	2131	Q16394		Homo sapiens	Prediction	More>>
1:1 ortholog	Ext1	14042	P97464	CPO	Mus musculus	Publication	More>>
1:1 ortholog	EXT1	107976420	K7DAN3		Pan troglodytes	Prediction	More>>
1:1 ortholog	EXT1	100157655	F1S274		Sus scrofa	Prediction	More>>
1:1 ortholog	Ext1	299907	G3V901		Rattus norvegicus	Prediction	More>>
1:1 ortholog	ext1a		Q5IGR8		Danio rerio	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs770545182	p.Ala3Ser	missense variant	-	NC_000008.11:g.118111040C>A	ExAC,gnomAD
rs61757381	p.Lys4Arg	missense variant	-	NC_000008.11:g.118111036T>C	gnomAD
rs1266937798	p.Lys4Gln	missense variant	-	NC_000008.11:g.118111037T>G	gnomAD
COSM3896356	p.Lys5Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118111033T>G	NCI-TCGA Cosmic
rs1226048368	p.Lys5Gln	missense variant	-	NC_000008.11:g.118111034T>G	gnomAD
rs200815125	p.Arg6Pro	missense variant	-	NC_000008.11:g.118111030C>G	ExAC,gnomAD
rs200815125	p.Arg6Leu	missense variant	-	NC_000008.11:g.118111030C>A	ExAC,gnomAD
rs772883826	p.Ile9Phe	missense variant	-	NC_000008.11:g.118111022T>A	ExAC,TOPMed,gnomAD
rs769143352	p.Leu11Val	missense variant	-	NC_000008.11:g.118111016G>C	ExAC
rs780457793	p.Ser12Leu	missense variant	-	NC_000008.11:g.118111012G>A	ExAC,gnomAD
rs1291059341	p.Ala13Gly	missense variant	-	NC_000008.11:g.118111009G>C	gnomAD
rs915340058	p.Ser15Cys	missense variant	-	NC_000008.11:g.118111003G>C	TOPMed,gnomAD
rs545138851	p.Cys16Phe	missense variant	-	NC_000008.11:g.118111000C>A	1000Genomes,ExAC,gnomAD
rs751570075	p.Leu19Phe	missense variant	-	NC_000008.11:g.118110992G>A	ExAC,TOPMed,gnomAD
rs1064795778	p.Phe21Ter	stop gained	-	NC_000008.11:g.118110985_118110986insTT	-
RCV000483890	p.Phe21Ter	nonsense	-	NC_000008.11:g.118110985_118110986insTT	ClinVar
rs200276819	p.Phe23Leu	missense variant	-	NC_000008.11:g.118110978G>T	ExAC,TOPMed,gnomAD
rs1306372997	p.Gly24Val	missense variant	-	NC_000008.11:g.118110976C>A	gnomAD
rs752644731	p.Gly25Arg	missense variant	-	NC_000008.11:g.118110974C>G	ExAC,TOPMed,gnomAD
rs765050783	p.Gly25Asp	missense variant	-	NC_000008.11:g.118110973C>T	ExAC,TOPMed,gnomAD
VAR_012815	p.Gln27Lys	Missense	Hereditary multiple exostoses 1 (EXT1) [MIM:133700]	-	UniProt
rs533027765	p.Ala30Thr	missense variant	-	NC_000008.11:g.118110959C>T	1000Genomes,ExAC,gnomAD
rs766091879	p.Ser31Leu	missense variant	-	NC_000008.11:g.118110955G>A	ExAC,gnomAD
COSM6112161	p.Ser31Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110956A>G	NCI-TCGA Cosmic
rs147654656	p.Ser33Arg	missense variant	-	NC_000008.11:g.118110948G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs147654656	p.Ser33Arg	missense variant	-	NC_000008.11:g.118110948G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs771543794	p.His34Tyr	missense variant	-	NC_000008.11:g.118110947G>A	ExAC,gnomAD
rs749767023	p.His34Arg	missense variant	-	NC_000008.11:g.118110946T>C	ExAC,gnomAD
rs775906242	p.Ser35Arg	missense variant	-	NC_000008.11:g.118110942G>C	ExAC,TOPMed,gnomAD
RCV000704322	p.Ser35Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110944del	ClinVar
rs746188012	p.Arg36Leu	missense variant	-	NC_000008.11:g.118110940C>A	ExAC,TOPMed,gnomAD
rs770352704	p.Arg36Trp	missense variant	-	NC_000008.11:g.118110941G>A	ExAC,TOPMed,gnomAD
rs746188012	p.Arg36Gln	missense variant	-	NC_000008.11:g.118110940C>T	ExAC,TOPMed,gnomAD
rs757411850	p.Arg37Lys	missense variant	-	NC_000008.11:g.118110937C>T	ExAC,TOPMed,gnomAD
rs747288908	p.Glu38Gln	missense variant	-	NC_000008.11:g.118110935C>G	ExAC,gnomAD
rs794726874	p.Glu38Gly	missense variant	-	NC_000008.11:g.118110934T>C	TOPMed,gnomAD
RCV000173067	p.Glu38Gly	missense variant	-	NC_000008.11:g.118110934T>C	ClinVar
rs78429222	p.Glu39Asp	missense variant	-	NC_000008.11:g.118110930T>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
COSM1095384	p.Glu39Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110932C>T	NCI-TCGA Cosmic
rs1186563531	p.Ser41Arg	missense variant	-	NC_000008.11:g.118110924G>T	gnomAD
RCV000120870	p.Ser41Asn	missense variant	-	NC_000008.11:g.118110925C>T	ClinVar
rs199862937	p.Ser41Asn	missense variant	-	NC_000008.11:g.118110925C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs754998142	p.Gly42Asp	missense variant	-	NC_000008.11:g.118110922C>T	ExAC,TOPMed,gnomAD
rs368382074	p.Gly42Ser	missense variant	-	NC_000008.11:g.118110923C>T	ESP,ExAC,TOPMed,gnomAD
rs1199393037	p.Arg43Lys	missense variant	-	NC_000008.11:g.118110919C>T	gnomAD
rs1482036956	p.Arg43Ser	missense variant	-	NC_000008.11:g.118110918C>G	gnomAD
rs1182285664	p.Asn44Asp	missense variant	-	NC_000008.11:g.118110917T>C	TOPMed
NCI-TCGA novel	p.Gly45Asp	missense variant	-	NC_000008.11:g.118110913C>T	NCI-TCGA
NCI-TCGA novel	p.His47Tyr	missense variant	-	NC_000008.11:g.118110908G>A	NCI-TCGA
rs1052157677	p.His47Asp	missense variant	-	NC_000008.11:g.118110908G>C	TOPMed,gnomAD
COSM1095383	p.Pro49His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110901G>T	NCI-TCGA Cosmic
rs150846666	p.Pro49Arg	missense variant	-	NC_000008.11:g.118110901G>C	ESP,ExAC,TOPMed,gnomAD
rs772811741	p.Ser50Gly	missense variant	-	NC_000008.11:g.118110899T>C	ExAC,TOPMed,gnomAD
RCV000268096	p.Ser50Gly	missense variant	Hereditary Multiple Osteochondromatosis	NC_000008.11:g.118110899T>C	ClinVar
rs761175866	p.Pro51Arg	missense variant	-	NC_000008.11:g.118110895G>C	ExAC,gnomAD
rs761175866	p.Pro51Leu	missense variant	-	NC_000008.11:g.118110895G>A	ExAC,gnomAD
rs375138320	p.Pro51Ser	missense variant	-	NC_000008.11:g.118110896G>A	ESP,ExAC,gnomAD
rs371717237	p.Asp52Tyr	missense variant	-	NC_000008.11:g.118110893C>A	ESP,ExAC,TOPMed,gnomAD
rs1390552631	p.His53Gln	missense variant	-	NC_000008.11:g.118110888A>T	TOPMed
rs770218370	p.Phe54Leu	missense variant	-	NC_000008.11:g.118110885G>T	ExAC,TOPMed,gnomAD
rs1187165813	p.Trp55Gly	missense variant	-	NC_000008.11:g.118110884A>C	TOPMed,gnomAD
rs368004125	p.Pro56Ser	missense variant	-	NC_000008.11:g.118110881G>A	ESP,ExAC,gnomAD
rs142365518	p.Ala61Pro	missense variant	-	NC_000008.11:g.118110866C>G	ESP,TOPMed
rs373794512	p.Leu62Met	missense variant	-	NC_000008.11:g.118110863G>T	ESP,ExAC,TOPMed,gnomAD
rs187891947	p.Arg63Leu	missense variant	-	NC_000008.11:g.118110859C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs187891947	p.Arg63His	missense variant	-	NC_000008.11:g.118110859C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs187891947	p.Arg63Pro	missense variant	-	NC_000008.11:g.118110859C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs772363578	p.Pro64Ser	missense variant	-	NC_000008.11:g.118110857G>A	ExAC,gnomAD
rs748138510	p.Pro64Leu	missense variant	-	NC_000008.11:g.118110856G>A	ExAC,gnomAD
rs1242925512	p.Val66Gly	missense variant	-	NC_000008.11:g.118110850A>C	TOPMed
rs371817652	p.Pro67Arg	missense variant	-	NC_000008.11:g.118110847G>C	ESP,ExAC,TOPMed,gnomAD
rs371817652	p.Pro67His	missense variant	-	NC_000008.11:g.118110847G>T	ESP,ExAC,TOPMed,gnomAD
rs1177400977	p.Asp69Gly	missense variant	-	NC_000008.11:g.118110841T>C	gnomAD
rs367543871	p.Gln70His	missense variant	-	NC_000008.11:g.118110837T>A	ESP,ExAC,TOPMed,gnomAD
rs1272922541	p.Leu71Phe	missense variant	-	NC_000008.11:g.118110834C>G	gnomAD
rs150818931	p.Glu72Lys	missense variant	-	NC_000008.11:g.118110833C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000822823	p.Glu72Lys	missense variant	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110833C>T	ClinVar
rs750250958	p.Asn73Lys	missense variant	-	NC_000008.11:g.118110828G>T	ExAC,gnomAD
RCV000630811	p.Asn73Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110832del	ClinVar
rs1265397820	p.Asn73Ser	missense variant	-	NC_000008.11:g.118110829T>C	gnomAD
NCI-TCGA novel	p.Glu74Gln	missense variant	-	NC_000008.11:g.118110827C>G	NCI-TCGA
rs1318780364	p.Glu74Gly	missense variant	-	NC_000008.11:g.118110826T>C	gnomAD
rs867664035	p.Asp75Tyr	missense variant	-	NC_000008.11:g.118110824C>A	gnomAD
rs867664035	p.Asp75Asn	missense variant	-	NC_000008.11:g.118110824C>T	gnomAD
rs1409426317	p.Ser76Tyr	missense variant	-	NC_000008.11:g.118110820G>T	gnomAD
rs768341134	p.Ser77Arg	missense variant	-	NC_000008.11:g.118110816G>T	ExAC,gnomAD
rs767034189	p.Ser77Gly	missense variant	-	NC_000008.11:g.118110818T>C	ExAC,gnomAD
rs763650236	p.Val78Met	missense variant	-	NC_000008.11:g.118110815C>T	ExAC,gnomAD
COSM3833931	p.Val78Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110814A>T	NCI-TCGA Cosmic
rs1456372365	p.Ser81Cys	missense variant	-	NC_000008.11:g.118110805G>C	gnomAD
rs1456372365	p.Ser81Phe	missense variant	-	NC_000008.11:g.118110805G>A	gnomAD
rs760030507	p.Pro82Ser	missense variant	-	NC_000008.11:g.118110803G>A	ExAC,gnomAD
rs1038504618	p.Pro82Leu	missense variant	-	NC_000008.11:g.118110802G>A	TOPMed,gnomAD
rs1249187315	p.Arg83Gly	missense variant	-	NC_000008.11:g.118110800G>C	gnomAD
RCV000598686	p.Arg83Ter	frameshift	-	NC_000008.11:g.118110805dup	ClinVar
NCI-TCGA novel	p.Arg83GlyPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.118110800G>-	NCI-TCGA
NCI-TCGA novel	p.Arg83ProPheSerTerUnkUnkUnk	frameshift	-	NC_000008.11:g.118110799_118110800insG	NCI-TCGA
rs1064793753	p.Gln84Ter	stop gained	-	NC_000008.11:g.118110797G>A	-
RCV000483829	p.Gln84Ter	nonsense	-	NC_000008.11:g.118110797G>A	ClinVar
rs376231630	p.Gln84His	missense variant	-	NC_000008.11:g.118110795C>G	ESP,ExAC,TOPMed,gnomAD
rs201918002	p.Gln84Arg	missense variant	-	NC_000008.11:g.118110796T>C	1000Genomes,ExAC,gnomAD
NCI-TCGA novel	p.Ser90Tyr	missense variant	-	NC_000008.11:g.118110778G>T	NCI-TCGA
rs779457389	p.Ser90Cys	missense variant	-	NC_000008.11:g.118110778G>C	gnomAD
rs772121819	p.Ile92Phe	missense variant	-	NC_000008.11:g.118110773T>A	ExAC
rs1227875610	p.Tyr93Ter	stop gained	-	NC_000008.11:g.118110768G>C	gnomAD
rs1261383828	p.Tyr93Cys	missense variant	-	NC_000008.11:g.118110769T>C	gnomAD
RCV000630816	p.Tyr93Ter	nonsense	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110768G>C	ClinVar
rs1402667727	p.Tyr93Asn	missense variant	-	NC_000008.11:g.118110770A>T	TOPMed
rs1327278823	p.Lys94Arg	missense variant	-	NC_000008.11:g.118110766T>C	gnomAD
RCV000688480	p.Gly95Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110767dup	ClinVar
COSM1095382	p.Lys97Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110757T>G	NCI-TCGA Cosmic
rs1397695425	p.Arg99Cys	missense variant	-	NC_000008.11:g.118110752G>A	TOPMed
rs778849200	p.Arg99Leu	missense variant	-	NC_000008.11:g.118110751C>A	ExAC,TOPMed,gnomAD
rs768927789	p.Met100Ile	missense variant	-	NC_000008.11:g.118110747C>G	ExAC,gnomAD
rs1331448500	p.Met100Leu	missense variant	-	NC_000008.11:g.118110749T>G	gnomAD
rs1350817754	p.Glu101Gln	missense variant	-	NC_000008.11:g.118110746C>G	gnomAD
rs1384997375	p.Glu101Gly	missense variant	-	NC_000008.11:g.118110745T>C	gnomAD
COSM202327	p.Cys103Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110739C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Cys103ValPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.118110741_118110742insGACT	NCI-TCGA
rs1242235773	p.Cys103Arg	missense variant	-	NC_000008.11:g.118110740A>G	gnomAD
RCV000627629	p.Asp105Ter	frameshift	-	NC_000008.11:g.118110734del	ClinVar
COSM1330345	p.Phe106Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110731A>T	NCI-TCGA Cosmic
rs1178109514	p.Lys110Arg	missense variant	-	NC_000008.11:g.118110718T>C	gnomAD
NCI-TCGA novel	p.Asn112LysPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.118110711_118110712insT	NCI-TCGA
rs750116273	p.Gly113Ser	missense variant	-	NC_000008.11:g.118110710C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly113Asp	missense variant	-	NC_000008.11:g.118110709C>T	NCI-TCGA
rs1377414352	p.Phe114Leu	missense variant	-	NC_000008.11:g.118110707A>G	gnomAD
rs146127753	p.Lys115Thr	missense variant	-	NC_000008.11:g.118110703T>G	ESP,ExAC,TOPMed,gnomAD
rs146127753	p.Lys115Arg	missense variant	-	NC_000008.11:g.118110703T>C	ESP,ExAC,TOPMed,gnomAD
rs201368821	p.Lys115Asn	missense variant	-	NC_000008.11:g.118110702T>G	1000Genomes,ExAC,TOPMed,gnomAD
rs371163252	p.Val116Phe	missense variant	-	NC_000008.11:g.118110701C>A	ESP,TOPMed
COSM3833930	p.Tyr117Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110698A>T	NCI-TCGA Cosmic
rs763562992	p.Tyr117Cys	missense variant	-	NC_000008.11:g.118110697T>C	ExAC,gnomAD
rs1208144072	p.Val118Ile	missense variant	-	NC_000008.11:g.118110695C>T	gnomAD
rs1360494729	p.Tyr119Cys	missense variant	-	NC_000008.11:g.118110691T>C	gnomAD
rs1415760714	p.Tyr119His	missense variant	-	NC_000008.11:g.118110692A>G	gnomAD
RCV000002605	p.Tyr119Ter	nonsense	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110690G>T	ClinVar
rs119103289	p.Tyr119Ter	stop gained	-	NC_000008.11:g.118110690G>T	-
rs377676265	p.Pro120Ser	missense variant	-	NC_000008.11:g.118110689G>A	ESP,ExAC,gnomAD
rs752226935	p.Pro120Leu	missense variant	-	NC_000008.11:g.118110688G>A	ExAC,gnomAD
RCV000482388	p.Gln121Ter	frameshift	-	NC_000008.11:g.118110685del	ClinVar
rs1204529411	p.Gln121Leu	missense variant	-	NC_000008.11:g.118110685T>A	gnomAD
rs773394301	p.Lys123Arg	missense variant	-	NC_000008.11:g.118110679T>C	ExAC,gnomAD
rs773394301	p.Lys123Thr	missense variant	-	NC_000008.11:g.118110679T>G	ExAC,gnomAD
rs767986411	p.Gly124Arg	missense variant	-	NC_000008.11:g.118110677C>T	ExAC,gnomAD
rs761940324	p.Gly124Glu	missense variant	-	NC_000008.11:g.118110676C>T	ExAC,gnomAD
COSM1095380	p.Glu125Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110672C>A	NCI-TCGA Cosmic
rs143019224	p.Ile127Asn	missense variant	-	NC_000008.11:g.118110667A>T	ESP,ExAC
rs587778298	p.Ala128Ser	missense variant	-	NC_000008.11:g.118110665C>A	ExAC,gnomAD
COSM3896354	p.Ala128Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110665C>T	NCI-TCGA Cosmic
RCV000120871	p.Ala128Ser	missense variant	-	NC_000008.11:g.118110665C>A	ClinVar
rs775712594	p.Glu129Lys	missense variant	-	NC_000008.11:g.118110662C>T	ExAC,gnomAD
rs1249105856	p.Ser130Asn	missense variant	-	NC_000008.11:g.118110658C>T	TOPMed
rs1414678503	p.Gln132Ter	stop gained	-	NC_000008.11:g.118110653G>A	gnomAD
NCI-TCGA novel	p.Asn133His	missense variant	-	NC_000008.11:g.118110650T>G	NCI-TCGA
rs938133710	p.Ile134Val	missense variant	-	NC_000008.11:g.118110647T>C	TOPMed
rs1171135662	p.Ala137Thr	missense variant	-	NC_000008.11:g.118110638C>T	gnomAD
COSM1496744	p.Glu139Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.118110632C>A	NCI-TCGA Cosmic
rs769557488	p.Gly140Val	missense variant	-	NC_000008.11:g.118110628C>A	ExAC,gnomAD
rs1188458258	p.Phe143Ser	missense variant	-	NC_000008.11:g.118110619A>G	gnomAD
rs1316804046	p.Tyr144Cys	missense variant	-	NC_000008.11:g.118110616T>C	gnomAD
rs1245037592	p.Asp147Tyr	missense variant	-	NC_000008.11:g.118110608C>A	gnomAD
rs1414318910	p.Ser149Asn	missense variant	-	NC_000008.11:g.118110601C>T	TOPMed
rs922587596	p.Gln150Lys	missense variant	-	NC_000008.11:g.118110599G>T	TOPMed
rs1385688129	p.Ala151Glu	missense variant	-	NC_000008.11:g.118110595G>T	gnomAD
rs1402547599	p.Ala151Ser	missense variant	-	NC_000008.11:g.118110596C>A	TOPMed,gnomAD
COSM269122	p.Ala151Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110595G>A	NCI-TCGA Cosmic
rs1554601534	p.Cys152Ter	stop gained	-	NC_000008.11:g.118110591G>T	-
RCV000579269	p.Cys152Ter	nonsense	-	NC_000008.11:g.118110591G>T	ClinVar
rs757114989	p.Phe154Leu	missense variant	-	NC_000008.11:g.118110587A>G	ExAC,TOPMed,gnomAD
COSM3644543	p.Phe154Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110585A>T	NCI-TCGA Cosmic
rs777356297	p.Leu156Pro	missense variant	-	NC_000008.11:g.118110580A>G	ExAC,gnomAD
NCI-TCGA novel	p.Leu156Met	missense variant	-	NC_000008.11:g.118110581G>T	NCI-TCGA
rs758078822	p.Leu158Val	missense variant	-	NC_000008.11:g.118110575G>C	ExAC,TOPMed,gnomAD
rs975395118	p.Thr160Asn	missense variant	-	NC_000008.11:g.118110568G>T	TOPMed
rs1410364563	p.Leu161Ser	missense variant	-	NC_000008.11:g.118110565A>G	TOPMed
rs752137032	p.Asp162Asn	missense variant	-	NC_000008.11:g.118110563C>T	ExAC,gnomAD
rs544496246	p.Arg163Gly	missense variant	-	NC_000008.11:g.118110560T>C	TOPMed
COSM6179657	p.Asp164Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110555G>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Asp164Tyr	missense variant	-	NC_000008.11:g.118110557C>A	NCI-TCGA
NCI-TCGA novel	p.Asp164Ala	missense variant	-	NC_000008.11:g.118110556T>G	NCI-TCGA
VAR_012816	p.Asp164His	Missense	Hereditary multiple exostoses 1 (EXT1) [MIM:133700]	-	UniProt
rs1227559201	p.Ser167Ala	missense variant	-	NC_000008.11:g.118110548A>C	gnomAD
COSM1313666	p.Gln169Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.118110542G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gln169Arg	missense variant	-	NC_000008.11:g.118110541T>C	NCI-TCGA
rs764741916	p.Tyr170Cys	missense variant	-	NC_000008.11:g.118110538T>C	ExAC,TOPMed,gnomAD
rs1403919037	p.His172Tyr	missense variant	-	NC_000008.11:g.118110533G>A	TOPMed
rs1448140995	p.Asn173Asp	missense variant	-	NC_000008.11:g.118110530T>C	gnomAD
RCV000585681	p.Asn173Ter	nonsense	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110528del	ClinVar
rs756568263	p.Arg175Gly	missense variant	-	NC_000008.11:g.118110524T>C	ExAC,gnomAD
rs762291120	p.Lys177Glu	missense variant	-	NC_000008.11:g.118110518T>C	ExAC,TOPMed,gnomAD
RCV000002603	p.Lys177Ter	frameshift	Chondrosarcoma	NC_000008.11:g.118110513_118110520del	ClinVar
rs886039561	p.Gln179Ter	stop gained	-	NC_000008.11:g.118110512G>A	-
RCV000630805	p.Gln179Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110514_118110515dup	ClinVar
RCV000255895	p.Gln179Ter	nonsense	-	NC_000008.11:g.118110512G>A	ClinVar
rs774883865	p.Ser180Thr	missense variant	-	NC_000008.11:g.118110508C>G	ExAC,TOPMed,gnomAD
COSM292640	p.Leu181Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110505A>G	NCI-TCGA Cosmic
COSM3896353	p.Leu181Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110506G>T	NCI-TCGA Cosmic
rs763278350	p.His182Tyr	missense variant	-	NC_000008.11:g.118110503G>A	ExAC
rs1387642251	p.Asn186Thr	missense variant	-	NC_000008.11:g.118110490T>G	TOPMed,gnomAD
rs1387642251	p.Asn186Ser	missense variant	-	NC_000008.11:g.118110490T>C	TOPMed,gnomAD
rs775696069	p.Arg188Met	missense variant	-	NC_000008.11:g.118110484C>A	ExAC,gnomAD
rs775696069	p.Arg188Lys	missense variant	-	NC_000008.11:g.118110484C>T	ExAC,gnomAD
RCV000685852	p.Leu191Ser	missense variant	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110475A>G	ClinVar
COSM6179658	p.Asn194Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110466T>C	NCI-TCGA Cosmic
RCV000521659	p.Asn194Ter	nonsense	-	NC_000008.11:g.118110472dup	ClinVar
rs776678803	p.Ser197Tyr	missense variant	-	NC_000008.11:g.118110457G>T	ExAC,gnomAD
rs776678803	p.Ser197Cys	missense variant	-	NC_000008.11:g.118110457G>C	ExAC,gnomAD
rs1184228548	p.Ser197Ala	missense variant	-	NC_000008.11:g.118110458A>C	gnomAD
NCI-TCGA novel	p.Gly198Asp	missense variant	-	NC_000008.11:g.118110454C>T	NCI-TCGA
rs746766470	p.Thr199Ser	missense variant	-	NC_000008.11:g.118110451G>C	ExAC,gnomAD
rs757995060	p.Val207Gly	missense variant	-	NC_000008.11:g.118110427A>C	ExAC,gnomAD
rs1228859857	p.Val207Met	missense variant	-	NC_000008.11:g.118110428C>T	TOPMed,gnomAD
rs1217793768	p.Gly208Glu	missense variant	-	NC_000008.11:g.118110424C>T	gnomAD
rs747844962	p.Ile211Ser	missense variant	-	NC_000008.11:g.118110415A>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly212Cys	missense variant	-	NC_000008.11:g.118110413C>A	NCI-TCGA
rs146407656	p.Gly212Ala	missense variant	-	NC_000008.11:g.118110412C>G	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala214Thr	missense variant	-	NC_000008.11:g.118110407C>T	NCI-TCGA
rs750877327	p.Met215Leu	missense variant	-	NC_000008.11:g.118110404T>A	ExAC,gnomAD
NCI-TCGA novel	p.Met215LysPheSerTerUnk	frameshift	-	NC_000008.11:g.118110377_118110405CAGTACTGATGCTGGCTTTGGCCAGCATC>-	NCI-TCGA
VAR_012817	p.Met215_Ile221del	inframe_deletion	Hereditary multiple exostoses 1 (EXT1) [MIM:133700]	-	UniProt
VAR_012818	p.Met215_Ser222delinsIle	deletion_insertion	-	-	UniProt
rs781678414	p.Leu216Val	missense variant	-	NC_000008.11:g.118110401G>C	ExAC,TOPMed,gnomAD
rs757740272	p.Ala217Val	missense variant	-	NC_000008.11:g.118110397G>A	ExAC,gnomAD
RCV000630803	p.Lys218Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110400_118110403dup	ClinVar
RCV000630810	p.Lys218Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110385_118110397del	ClinVar
rs1405346511	p.Ala219Val	missense variant	-	NC_000008.11:g.118110391G>A	gnomAD
RCV000622308	p.Ser220Gly	missense variant	Inborn genetic diseases	NC_000008.11:g.118110389T>C	ClinVar
rs1554601506	p.Ser220Gly	missense variant	-	NC_000008.11:g.118110389T>C	-
rs751926824	p.Ile221Ser	missense variant	-	NC_000008.11:g.118110385A>C	ExAC,gnomAD
rs1473004303	p.Ser222Thr	missense variant	-	NC_000008.11:g.118110382C>G	gnomAD
rs149242997	p.Thr223Ile	missense variant	-	NC_000008.11:g.118110379G>A	ESP,ExAC,TOPMed,gnomAD
rs1336562431	p.Phe226Leu	missense variant	-	NC_000008.11:g.118110369G>T	gnomAD
COSM1095378	p.Arg227Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110367C>T	NCI-TCGA Cosmic
rs753036738	p.Asn229Ser	missense variant	-	NC_000008.11:g.118110361T>C	ExAC,gnomAD
rs1003279912	p.Ile234Val	missense variant	-	NC_000008.11:g.118110347T>C	TOPMed,gnomAD
rs1003279912	p.Ile234Phe	missense variant	-	NC_000008.11:g.118110347T>A	TOPMed,gnomAD
VAR_012819	p.Pro235_Lys239del	inframe_deletion	-	-	UniProt
rs1451032732	p.Leu236Val	missense variant	-	NC_000008.11:g.118110341G>C	gnomAD
rs759603929	p.Asp240His	missense variant	-	NC_000008.11:g.118110329C>G	ExAC,gnomAD
rs906230630	p.Pro242Leu	missense variant	-	NC_000008.11:g.118110322G>A	TOPMed
NCI-TCGA novel	p.Arg243Ser	missense variant	-	NC_000008.11:g.118110318C>A	NCI-TCGA
rs1293618270	p.Gly246Glu	missense variant	-	NC_000008.11:g.118110310C>T	TOPMed
rs1287362675	p.Gly246Trp	missense variant	-	NC_000008.11:g.118110311C>A	gnomAD
rs1380196220	p.Arg248Lys	missense variant	-	NC_000008.11:g.118110304C>T	TOPMed
rs920291906	p.Phe250Ile	missense variant	-	NC_000008.11:g.118110299A>T	TOPMed,gnomAD
rs1294549175	p.Leu251Met	missense variant	-	NC_000008.11:g.118110296A>T	gnomAD
rs1436385815	p.Phe253Leu	missense variant	-	NC_000008.11:g.118110290A>G	TOPMed,gnomAD
rs1433419013	p.Asn254Tyr	missense variant	-	NC_000008.11:g.118110287T>A	gnomAD
rs1348650954	p.Thr255Asn	missense variant	-	NC_000008.11:g.118110283G>T	gnomAD
rs768201929	p.Pro258Ala	missense variant	-	NC_000008.11:g.118110275G>C	ExAC,TOPMed,gnomAD
rs768201929	p.Pro258Ser	missense variant	-	NC_000008.11:g.118110275G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro258Leu	missense variant	-	NC_000008.11:g.118110274G>A	NCI-TCGA
COSM453913	p.Lys261Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.118110266T>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Tyr262His	missense variant	-	NC_000008.11:g.118110263A>G	NCI-TCGA
rs1481574908	p.Met263Val	missense variant	-	NC_000008.11:g.118110260T>C	gnomAD
rs377162411	p.Leu264Gln	missense variant	-	NC_000008.11:g.118110256A>T	ESP,ExAC,gnomAD
rs779457224	p.Leu264Val	missense variant	-	NC_000008.11:g.118110257G>C	ExAC,gnomAD
NCI-TCGA novel	p.Val265Ile	missense variant	-	NC_000008.11:g.118110254C>T	NCI-TCGA
RCV000690444	p.Phe266Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110249del	ClinVar
rs1554601492	p.Gly268Arg	missense variant	-	NC_000008.11:g.118110245C>G	-
RCV000255528	p.Gly268Glu	missense variant	-	NC_000008.11:g.118110244C>T	ClinVar
RCV000520277	p.Gly268Arg	missense variant	-	NC_000008.11:g.118110245C>G	ClinVar
rs886039352	p.Gly268Glu	missense variant	-	NC_000008.11:g.118110244C>T	-
rs1244929754	p.Arg270Ser	missense variant	-	NC_000008.11:g.118110237C>G	gnomAD
rs1477621319	p.Arg270Lys	missense variant	-	NC_000008.11:g.118110238C>T	gnomAD
rs1064793786	p.Tyr271Cys	missense variant	-	NC_000008.11:g.118110235T>C	-
RCV000486275	p.Tyr271Cys	missense variant	-	NC_000008.11:g.118110235T>C	ClinVar
rs1185024233	p.Thr273Arg	missense variant	-	NC_000008.11:g.118110229G>C	TOPMed
rs752153917	p.Thr273Ala	missense variant	-	NC_000008.11:g.118110230T>C	ExAC,TOPMed,gnomAD
RCV000397830	p.Gly274Ter	frameshift	-	NC_000008.11:g.118110227_118110228del	ClinVar
rs778280138	p.Ile275Val	missense variant	-	NC_000008.11:g.118110224T>C	ExAC,TOPMed,gnomAD
rs778280138	p.Ile275Leu	missense variant	-	NC_000008.11:g.118110224T>A	ExAC,TOPMed,gnomAD
rs1038559683	p.Gly276Glu	missense variant	-	NC_000008.11:g.118110220C>T	TOPMed
NCI-TCGA novel	p.Gly276Val	missense variant	-	NC_000008.11:g.118110220C>A	NCI-TCGA
rs753126504	p.Asp278Ala	missense variant	-	NC_000008.11:g.118110214T>G	ExAC,gnomAD
rs1554601483	p.Arg280Gly	missense variant	-	NC_000008.11:g.118110209T>C	-
rs1554601483	p.Arg280Gly	missense variant	Hereditary multiple exostoses 1 (EXT1)	NC_000008.11:g.118110209T>C	UniProt,dbSNP
VAR_002370	p.Arg280Gly	missense variant	Hereditary multiple exostoses 1 (EXT1)	NC_000008.11:g.118110209T>C	UniProt
RCV000630813	p.Arg280Gly	missense variant	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110209T>C	ClinVar
RCV000699208	p.Arg280Ser	missense variant	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110207C>G	ClinVar
VAR_002371	p.Arg280Ser	Missense	Hereditary multiple exostoses 1 (EXT1) [MIM:133700]	-	UniProt
rs1383240763	p.Asn281Asp	missense variant	-	NC_000008.11:g.118110206T>C	TOPMed
RCV000630814	p.Leu283Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110202del	ClinVar
rs1302336455	p.Tyr284His	missense variant	-	NC_000008.11:g.118110197A>G	gnomAD
rs1057520608	p.Tyr284Ter	stop gained	-	NC_000008.11:g.118110195A>T	-
RCV000800945	p.Tyr284Ter	nonsense	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110195A>T	ClinVar
RCV000440581	p.Tyr284Ter	nonsense	-	NC_000008.11:g.118110195A>T	ClinVar
RCV000482528	p.His285Ter	frameshift	-	NC_000008.11:g.118110193dup	ClinVar
RCV000692334	p.His285Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.118110193dup	ClinVar
rs551552671	p.Val286Leu	missense variant	-	NC_000008.11:g.118110191C>G	1000Genomes,ExAC,gnomAD
rs551552671	p.Val286Phe	missense variant	-	NC_000008.11:g.118110191C>A	1000Genomes,ExAC,gnomAD
rs759708614	p.Glu290Gln	missense variant	-	NC_000008.11:g.118110179C>G	ExAC,gnomAD
rs1423177713	p.Asp291Asn	missense variant	-	NC_000008.11:g.118110176C>T	TOPMed
rs372750330	p.Asp291Glu	missense variant	-	NC_000008.11:g.118110174G>C	ESP,ExAC,TOPMed,gnomAD
rs760572042	p.Leu294Val	missense variant	-	NC_000008.11:g.118110167G>C	ExAC,gnomAD
rs1318697804	p.Thr296Asn	missense variant	-	NC_000008.11:g.118110160G>T	gnomAD
rs773198507	p.His300Arg	missense variant	-	NC_000008.11:g.118110148T>C	ExAC,gnomAD
rs1176457130	p.Asp303Glu	missense variant	-	NC_000008.11:g.118110138G>C	TOPMed,gnomAD
rs1413726979	p.Trp304Gly	missense variant	-	NC_000008.11:g.118110137A>C	gnomAD
NCI-TCGA novel	p.Trp304Cys	missense variant	-	NC_000008.11:g.118110135C>A	NCI-TCGA
RCV000578854	p.Gln305Ter	nonsense	-	NC_000008.11:g.118110134G>A	ClinVar
rs1554601474	p.Gln305Ter	stop gained	-	NC_000008.11:g.118110134G>A	-
RCV000482859	p.His307Ter	frameshift	-	NC_000008.11:g.118110133dup	ClinVar
rs771837506	p.Lys308Arg	missense variant	-	NC_000008.11:g.118110124T>C	ExAC,TOPMed,gnomAD
rs908702874	p.Ser310Phe	missense variant	-	NC_000008.11:g.118110118G>A	TOPMed
rs774050402	p.Arg311Leu	missense variant	-	NC_000008.11:g.118110115C>A	ExAC
rs1191253387	p.Arg314Ser	missense variant	-	NC_000008.11:g.118110105T>G	TOPMed,gnomAD
VAR_012820	p.Asn316Ser	Missense	-	-	UniProt
rs748945641	p.Thr317Ser	missense variant	-	NC_000008.11:g.118110097G>C	ExAC,TOPMed,gnomAD
COSM453911	p.Glu320GlyPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.118110088T>-	NCI-TCGA Cosmic
rs1483996169	p.Glu320Gln	missense variant	-	NC_000008.11:g.118110089C>G	gnomAD
rs779587832	p.Lys321Arg	missense variant	-	NC_000008.11:g.118110085T>C	ExAC,gnomAD
rs1554580158	p.Tyr324Ter	stop gained	-	NC_000008.11:g.117837192A>T	-
RCV000521970	p.Tyr324Ter	nonsense	-	NC_000008.11:g.117837192A>T	ClinVar
rs1394508840	p.Arg325Trp	missense variant	-	NC_000008.11:g.117837191G>A	TOPMed,gnomAD
rs748651137	p.Arg325Gln	missense variant	-	NC_000008.11:g.117837190C>T	ExAC,TOPMed,gnomAD
rs755363067	p.His329Arg	missense variant	-	NC_000008.11:g.117837178T>C	ExAC,TOPMed,gnomAD
rs755363067	p.His329Pro	missense variant	-	NC_000008.11:g.117837178T>G	ExAC,TOPMed,gnomAD
RCV000693405	p.Asn330Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117837175_117837176insGA	ClinVar
rs1554580153	p.Ala331Asp	missense variant	-	NC_000008.11:g.117837172G>T	-
RCV000531791	p.Ala331Asp	missense variant	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117837172G>T	ClinVar
rs1296350429	p.Thr332Ser	missense variant	-	NC_000008.11:g.117837170T>A	gnomAD
rs1386640697	p.Thr332Ser	missense variant	-	NC_000008.11:g.117837169G>C	TOPMed
rs201458269	p.Phe333Leu	missense variant	-	NC_000008.11:g.117837165G>T	TOPMed,gnomAD
rs201458269	p.Phe333Leu	missense variant	-	NC_000008.11:g.117837165G>C	TOPMed,gnomAD
rs538199953	p.Cys334Tyr	missense variant	-	NC_000008.11:g.117837163C>T	1000Genomes,ExAC,gnomAD
rs538199953	p.Cys334Phe	missense variant	-	NC_000008.11:g.117837163C>A	1000Genomes,ExAC,gnomAD
rs756329599	p.Val336Ile	missense variant	-	NC_000008.11:g.117837158C>T	ExAC,TOPMed,gnomAD
rs1288618931	p.Arg338His	missense variant	-	NC_000008.11:g.117837151C>T	TOPMed
rs119103288	p.Gly339Asp	missense variant	-	NC_000008.11:g.117837148C>T	-
RCV000002604	p.Gly339Asp	missense variant	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117837148C>T	ClinVar
rs119103290	p.Arg340Cys	missense variant	-	NC_000008.11:g.117837146G>A	-
rs119103287	p.Arg340His	missense variant	-	NC_000008.11:g.117837145C>T	ExAC,gnomAD
RCV000255752	p.Arg340Cys	missense variant	-	NC_000008.11:g.117837146G>A	ClinVar
RCV000002601	p.Arg340Leu	missense variant	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117837145C>A	ClinVar
RCV000002606	p.Arg340Cys	missense variant	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117837146G>A	ClinVar
RCV000254839	p.Arg340His	missense variant	-	NC_000008.11:g.117837145C>T	ClinVar
RCV000630812	p.Arg340His	missense variant	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117837145C>T	ClinVar
rs119103287	p.Arg340Leu	missense variant	-	NC_000008.11:g.117837145C>A	ExAC,gnomAD
VAR_002376	p.Arg340Ser	Missense	Hereditary multiple exostoses 1 (EXT1) [MIM:133700]	-	UniProt
rs1554580149	p.Arg341Gly	missense variant	-	NC_000008.11:g.117837143T>C	-
rs1554580149	p.Arg341Trp	missense variant	-	NC_000008.11:g.117837143T>A	-
RCV000520066	p.Arg341Trp	missense variant	-	NC_000008.11:g.117837143T>A	ClinVar
RCV000799887	p.Arg341Gly	missense variant	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117837143T>C	ClinVar
COSM453910	p.Leu342Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117837140G>T	NCI-TCGA Cosmic
rs978347552	p.Gly343Trp	missense variant	-	NC_000008.11:g.117837137C>A	gnomAD
rs1206600641	p.Gly343Glu	missense variant	-	NC_000008.11:g.117837136C>T	TOPMed
RCV000630808	p.Arg346Gly	missense variant	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117837128T>C	ClinVar
rs1554580147	p.Arg346Gly	missense variant	-	NC_000008.11:g.117837128T>C	-
rs1212142934	p.Leu348Met	missense variant	-	NC_000008.11:g.117837122G>T	gnomAD
rs1300462534	p.Ala354Ser	missense variant	-	NC_000008.11:g.117835548C>A	gnomAD
RCV000827733	p.Val356Ile	missense variant	-	NC_000008.11:g.117835542C>T	ClinVar
RCV000307037	p.Val356Ile	missense variant	Hereditary Multiple Osteochondromatosis	NC_000008.11:g.117835542C>T	ClinVar
NCI-TCGA novel	p.Val356SerPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.117835530_117835542GCATCACAGGGAC>-	NCI-TCGA
rs61753260	p.Val356Ile	missense variant	-	NC_000008.11:g.117835542C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1131691337	p.Pro357Arg	missense variant	-	NC_000008.11:g.117835538G>C	-
RCV000494520	p.Pro357Arg	missense variant	-	NC_000008.11:g.117835538G>C	ClinVar
rs760043953	p.Val358Met	missense variant	-	NC_000008.11:g.117835536C>T	ExAC,TOPMed,gnomAD
rs760043953	p.Val358Leu	missense variant	-	NC_000008.11:g.117835536C>G	ExAC,TOPMed,gnomAD
rs549241569	p.Met359Lys	missense variant	-	NC_000008.11:g.117835532A>T	1000Genomes,ExAC,gnomAD
COSM3896352	p.Met359Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117835531C>T	NCI-TCGA Cosmic
rs549241569	p.Met359Thr	missense variant	-	NC_000008.11:g.117835532A>G	1000Genomes,ExAC,gnomAD
rs1382345913	p.Ser361Gly	missense variant	-	NC_000008.11:g.117835527T>C	gnomAD
rs527518789	p.Asn362Ser	missense variant	-	NC_000008.11:g.117835523T>C	1000Genomes,ExAC,gnomAD
rs763568003	p.Gly363Arg	missense variant	-	NC_000008.11:g.117835521C>G	ExAC,gnomAD
rs763568003	p.Gly363Arg	missense variant	-	NC_000008.11:g.117835521C>T	ExAC,gnomAD
rs1554580035	p.Trp364Ter	stop gained	-	NC_000008.11:g.117835516C>T	-
RCV000579192	p.Trp364Ter	nonsense	-	NC_000008.11:g.117835516C>T	ClinVar
rs1028715003	p.Glu365Lys	missense variant	-	NC_000008.11:g.117835515C>T	TOPMed
rs1371506021	p.Pro367Thr	missense variant	-	NC_000008.11:g.117835509G>T	gnomAD
rs1248648070	p.Val371Met	missense variant	-	NC_000008.11:g.117835497C>T	gnomAD
rs142122090	p.Asn373Asp	missense variant	-	NC_000008.11:g.117835491T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1463673192	p.Asn375Asp	missense variant	-	NC_000008.11:g.117835485T>C	gnomAD
rs746080792	p.Ala377Val	missense variant	-	NC_000008.11:g.117835478G>A	ExAC,gnomAD
rs371233961	p.Val379Ile	missense variant	-	NC_000008.11:g.117835473C>T	ESP,ExAC,TOPMed,gnomAD
rs371233961	p.Val379Phe	missense variant	-	NC_000008.11:g.117835473C>A	ESP,ExAC,TOPMed,gnomAD
RCV000120872	p.Val379Ile	missense variant	-	NC_000008.11:g.117835473C>T	ClinVar
rs747020325	p.Ile380Val	missense variant	-	NC_000008.11:g.117835470T>C	ExAC,TOPMed,gnomAD
rs747020325	p.Ile380Leu	missense variant	-	NC_000008.11:g.117835470T>G	ExAC,TOPMed,gnomAD
rs747020325	p.Ile380Leu	missense variant	-	NC_000008.11:g.117835470T>A	ExAC,TOPMed,gnomAD
RCV000176987	p.Ile380Leu	missense variant	-	NC_000008.11:g.117835470T>A	ClinVar
rs146983754	p.Asp382Asn	missense variant	-	NC_000008.11:g.117835464C>T	ESP,gnomAD
rs1057520535	p.Glu383Ter	stop gained	-	NC_000008.11:g.117835461C>A	-
RCV000441764	p.Glu383Ter	nonsense	-	NC_000008.11:g.117835461C>A	ClinVar
NCI-TCGA novel	p.Glu383Asp	missense variant	-	NC_000008.11:g.117835459C>A	NCI-TCGA
rs752721885	p.Arg384Lys	missense variant	-	NC_000008.11:g.117835457C>T	ExAC,TOPMed,gnomAD
rs374821962	p.Thr392Ile	missense variant	-	NC_000008.11:g.117830339G>A	ESP,ExAC,TOPMed,gnomAD
rs374821962	p.Thr392Lys	missense variant	-	NC_000008.11:g.117830339G>T	ESP,ExAC,TOPMed,gnomAD
rs748083628	p.Ile393Val	missense variant	-	NC_000008.11:g.117830337T>C	ExAC,gnomAD
rs1014256212	p.Arg394Gly	missense variant	-	NC_000008.11:g.117830334T>C	TOPMed
rs1441820398	p.Ser395Cys	missense variant	-	NC_000008.11:g.117830330G>C	TOPMed
rs749048200	p.Ile396Phe	missense variant	-	NC_000008.11:g.117830328T>A	ExAC,gnomAD
rs749048200	p.Ile396Val	missense variant	-	NC_000008.11:g.117830328T>C	ExAC,gnomAD
rs1222448496	p.His397Arg	missense variant	-	NC_000008.11:g.117830324T>C	gnomAD
rs561006425	p.Gln398Lys	missense variant	-	NC_000008.11:g.117830322G>T	1000Genomes,ExAC,gnomAD
rs1275929525	p.Asp399Val	missense variant	-	NC_000008.11:g.117830318T>A	TOPMed,gnomAD
rs1436463800	p.Lys400Glu	missense variant	-	NC_000008.11:g.117830316T>C	gnomAD
rs1368862860	p.Ile401Thr	missense variant	-	NC_000008.11:g.117830312A>G	gnomAD
NCI-TCGA novel	p.Leu404Pro	missense variant	-	NC_000008.11:g.117830303A>G	NCI-TCGA
COSM3929351	p.Gln406Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117830297T>C	NCI-TCGA Cosmic
rs755694640	p.Gln409Lys	missense variant	-	NC_000008.11:g.117830289G>T	ExAC,gnomAD
NCI-TCGA novel	p.Phe410Leu	missense variant	-	NC_000008.11:g.117830284G>T	NCI-TCGA
RCV000760420	p.Trp412Ter	nonsense	-	NC_000008.11:g.117830279C>T	ClinVar
RCV000270757	p.Glu413Asp	missense variant	Hereditary Multiple Osteochondromatosis	NC_000008.11:g.117830275C>A	ClinVar
rs756701753	p.Glu413Asp	missense variant	-	NC_000008.11:g.117830275C>A	ExAC,TOPMed,gnomAD
rs1350355119	p.Ala414Val	missense variant	-	NC_000008.11:g.117830273G>A	TOPMed
COSM453909	p.Tyr415Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.117830269A>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Glu420Asp	missense variant	-	NC_000008.11:g.117830254C>A	NCI-TCGA
rs147847222	p.Glu420Gly	missense variant	-	NC_000008.11:g.117830255T>C	ESP,ExAC,TOPMed,gnomAD
COSM1095376	p.Lys421Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117830251C>A	NCI-TCGA Cosmic
rs1427060439	p.Ile422Thr	missense variant	-	NC_000008.11:g.117830249A>G	TOPMed,gnomAD
rs1251797288	p.Val423Ile	missense variant	-	NC_000008.11:g.117830247C>T	TOPMed
rs1183473800	p.Thr425Ala	missense variant	-	NC_000008.11:g.117830241T>C	TOPMed
rs773539946	p.Leu427Val	missense variant	-	NC_000008.11:g.117830235G>C	ExAC,gnomAD
RCV000432157	p.Leu427Val	missense variant	-	NC_000008.11:g.117830235G>C	ClinVar
rs772435035	p.Glu428Gln	missense variant	-	NC_000008.11:g.117830232C>G	ExAC,gnomAD
rs748311058	p.Asp432Glu	missense variant	-	NC_000008.11:g.117822586G>C	gnomAD
rs942079736	p.Ile434Met	missense variant	-	NC_000008.11:g.117822580T>C	TOPMed,gnomAD
COSM3896350	p.Ile434Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117822582T>G	NCI-TCGA Cosmic
rs183760697	p.Phe435Leu	missense variant	-	NC_000008.11:g.117822577G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1277354611	p.His437Asp	missense variant	-	NC_000008.11:g.117822573G>C	gnomAD
rs1228119516	p.Ile438Thr	missense variant	-	NC_000008.11:g.117822569A>G	TOPMed
rs768927725	p.Ile438Met	missense variant	-	NC_000008.11:g.117822568T>C	ExAC,gnomAD
rs774546763	p.Ile438Val	missense variant	-	NC_000008.11:g.117822570T>C	ExAC,TOPMed,gnomAD
RCV000688370	p.Ser439Ter	nonsense	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117822566G>C	ClinVar
rs144550328	p.Arg440His	missense variant	-	NC_000008.11:g.117822563C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs762790189	p.Arg440Cys	missense variant	-	NC_000008.11:g.117822564G>A	ExAC,TOPMed,gnomAD
RCV000630804	p.Arg440His	missense variant	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117822563C>T	ClinVar
rs1313210405	p.Ser442Gly	missense variant	-	NC_000008.11:g.117822558T>C	TOPMed,gnomAD
rs531329914	p.Ile444Met	missense variant	-	NC_000008.11:g.117822550T>C	1000Genomes,ExAC,TOPMed,gnomAD
RCV000521590	p.Trp445Arg	missense variant	-	NC_000008.11:g.117822549A>G	ClinVar
rs1554579012	p.Trp445Arg	missense variant	-	NC_000008.11:g.117822549A>G	-
rs745637397	p.Asn446Lys	missense variant	-	NC_000008.11:g.117822544G>T	ExAC,TOPMed,gnomAD
RCV000781341	p.Lys447HisValThrValTer	nonsense	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117822546_117822568dup	ClinVar
rs1484937234	p.Pro449Leu	missense variant	-	NC_000008.11:g.117822536G>A	gnomAD
NCI-TCGA novel	p.Pro449Ser	missense variant	-	NC_000008.11:g.117822537G>A	NCI-TCGA
rs1430395411	p.Gly451Val	missense variant	-	NC_000008.11:g.117822530C>A	gnomAD
COSM3896349	p.Leu452Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117822528A>C	NCI-TCGA Cosmic
rs770549520	p.Leu452Phe	missense variant	-	NC_000008.11:g.117822526C>A	ExAC,gnomAD
rs201504622	p.Val454Leu	missense variant	-	NC_000008.11:g.117822522C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs201504622	p.Val454Ile	missense variant	-	NC_000008.11:g.117822522C>T	1000Genomes,ExAC,TOPMed,gnomAD
RCV000315374	p.Val454Ile	missense variant	Hereditary Multiple Osteochondromatosis	NC_000008.11:g.117822522C>T	ClinVar
RCV000395683	p.Val454Ile	missense variant	Langer-Giedion syndrome (TRPS2)	NC_000008.11:g.117822522C>T	ClinVar
rs756607210	p.Gln457Pro	missense variant	-	NC_000008.11:g.117822512T>G	ExAC,gnomAD
COSM1095375	p.Gln457His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117822511C>A	NCI-TCGA Cosmic
rs756607210	p.Gln457Arg	missense variant	-	NC_000008.11:g.117822512T>C	ExAC,gnomAD
COSM1095374	p.Ser459Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.117822506G>T	NCI-TCGA Cosmic
rs1427260383	p.Leu462Pro	missense variant	-	NC_000008.11:g.117822497A>G	TOPMed
rs1314115386	p.Gly463Val	missense variant	-	NC_000008.11:g.117822494C>A	TOPMed
COSM3896348	p.Asp464Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117822491T>A	NCI-TCGA Cosmic
rs1375505148	p.Tyr468Cys	missense variant	-	NC_000008.11:g.117822479T>C	TOPMed
RCV000539518	p.Tyr468Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117822481del	ClinVar
rs750748090	p.Tyr469Cys	missense variant	-	NC_000008.11:g.117822476T>C	ExAC,TOPMed,gnomAD
rs750748090	p.Tyr469Phe	missense variant	-	NC_000008.11:g.117822476T>A	ExAC,TOPMed,gnomAD
rs746738537	p.Ala470Thr	missense variant	-	NC_000008.11:g.117822474C>T	gnomAD
rs768039171	p.Ala470Val	missense variant	-	NC_000008.11:g.117822473G>A	ExAC,gnomAD
rs376449014	p.Leu472Phe	missense variant	-	NC_000008.11:g.117822466T>A	ESP,ExAC,gnomAD
rs1473758294	p.Gly473Asp	missense variant	-	NC_000008.11:g.117819794C>T	TOPMed
rs1231742212	p.Gly473Ser	missense variant	-	NC_000008.11:g.117822465C>T	gnomAD
rs1182351764	p.Leu474Val	missense variant	-	NC_000008.11:g.117819792A>C	TOPMed
rs1442814688	p.Lys475Asn	missense variant	-	NC_000008.11:g.117819787C>A	TOPMed
rs751005275	p.Pro476Thr	missense variant	-	NC_000008.11:g.117819786G>T	ExAC,gnomAD
RCV000120874	p.Pro477Arg	missense variant	-	NC_000008.11:g.117819782G>C	ClinVar
rs145720047	p.Pro477Arg	missense variant	-	NC_000008.11:g.117819782G>C	ESP,ExAC,TOPMed,gnomAD
rs1391879741	p.Ser478Phe	missense variant	-	NC_000008.11:g.117819779G>A	gnomAD
RCV000554263	p.Ser478Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117819786dup	ClinVar
RCV000627404	p.Ser478Ter	frameshift	-	NC_000008.11:g.117819786dup	ClinVar
rs751981937	p.Lys479Glu	missense variant	-	NC_000008.11:g.117819777T>C	ExAC,gnomAD
rs192596226	p.Lys479Arg	missense variant	-	NC_000008.11:g.117819776T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1327351154	p.Val483Leu	missense variant	-	NC_000008.11:g.117819765C>G	TOPMed
rs763107867	p.Ile484Phe	missense variant	-	NC_000008.11:g.117819762T>A	ExAC,gnomAD
rs1159467409	p.His485Arg	missense variant	-	NC_000008.11:g.117819758T>C	gnomAD
rs188859975	p.Ala486Val	missense variant	-	NC_000008.11:g.117819755G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000120875	p.Ala486Val	missense variant	-	NC_000008.11:g.117819755G>A	ClinVar
rs759514310	p.Thr488Asn	missense variant	-	NC_000008.11:g.117819749G>T	ExAC,TOPMed,gnomAD
rs759514310	p.Thr488Ser	missense variant	-	NC_000008.11:g.117819749G>C	ExAC,TOPMed,gnomAD
rs201112673	p.Pro489Thr	missense variant	-	NC_000008.11:g.117819747G>T	1000Genomes,ExAC,TOPMed,gnomAD
rs201112673	p.Pro489Ala	missense variant	-	NC_000008.11:g.117819747G>C	1000Genomes,ExAC,TOPMed,gnomAD
RCV000697332	p.Leu490Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117819749dup	ClinVar
RCV000255218	p.Leu490Ter	frameshift	-	NC_000008.11:g.117819749del	ClinVar
NCI-TCGA novel	p.Leu490TrpPheSerTerUnk	frameshift	-	NC_000008.11:g.117819744G>-	NCI-TCGA
RCV000255784	p.Leu490Ter	frameshift	-	NC_000008.11:g.117819743del	ClinVar
RCV000702125	p.Leu490Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117819743del	ClinVar
RCV000309326	p.Leu490Ter	frameshift	-	NC_000008.11:g.117819749dup	ClinVar
RCV000821985	p.Leu490Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117819749del	ClinVar
rs369235843	p.Ser492Phe	missense variant	-	NC_000008.11:g.117819737G>A	ESP,TOPMed
rs773877597	p.Ser494Phe	missense variant	-	NC_000008.11:g.117819731G>A	ExAC,gnomAD
rs1248917798	p.Ser494Pro	missense variant	-	NC_000008.11:g.117819732A>G	gnomAD
COSM3164991	p.Gln495His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117819727C>A	NCI-TCGA Cosmic
rs139784916	p.Pro496Ser	missense variant	-	NC_000008.11:g.117819726G>A	ESP,ExAC,TOPMed,gnomAD
VAR_012822	p.Pro496Leu	Missense	Hereditary multiple exostoses 1 (EXT1) [MIM:133700]	-	UniProt
rs781738386	p.Lys499Arg	missense variant	-	NC_000008.11:g.117819716T>C	ExAC,gnomAD
NCI-TCGA novel	p.Leu501LysAsnPheTer	stop gained	-	NC_000008.11:g.117819708_117819709insTTAGAAATTCTT	NCI-TCGA
rs778048374	p.Val502Leu	missense variant	-	NC_000008.11:g.117819708C>G	ExAC,TOPMed,gnomAD
rs778048374	p.Val502Met	missense variant	-	NC_000008.11:g.117819708C>T	ExAC,TOPMed,gnomAD
rs778048374	p.Val502Leu	missense variant	-	NC_000008.11:g.117819708C>A	ExAC,TOPMed,gnomAD
rs1460054632	p.Ala503Val	missense variant	-	NC_000008.11:g.117819704G>A	TOPMed
rs752931018	p.Ala504Val	missense variant	-	NC_000008.11:g.117819701G>A	ExAC,gnomAD
COSM3896347	p.Lys506Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117819695T>A	NCI-TCGA Cosmic
rs201675147	p.Lys506Arg	missense variant	-	NC_000008.11:g.117819695T>C	1000Genomes
rs1468056863	p.Gln508His	missense variant	-	NC_000008.11:g.117819688C>G	gnomAD
rs915757314	p.Gln508Arg	missense variant	-	NC_000008.11:g.117819689T>C	TOPMed
rs1475246488	p.Tyr509Cys	missense variant	-	NC_000008.11:g.117819686T>C	TOPMed
rs1383256196	p.Gln512Glu	missense variant	-	NC_000008.11:g.117819678G>C	gnomAD
rs1188968853	p.Ile513Val	missense variant	-	NC_000008.11:g.117818530T>C	gnomAD
COSM1454476	p.Ile513Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117818529A>G	NCI-TCGA Cosmic
rs1475399570	p.Ile514Met	missense variant	-	NC_000008.11:g.117818525T>C	gnomAD
rs750392304	p.Asn518Thr	missense variant	-	NC_000008.11:g.117818514T>G	ExAC,gnomAD
rs1199361133	p.Asn518Lys	missense variant	-	NC_000008.11:g.117818513A>T	TOPMed
rs1554578706	p.Cys519Ter	stop gained	-	NC_000008.11:g.117818510A>T	-
RCV000523456	p.Cys519Ter	nonsense	-	NC_000008.11:g.117818510A>T	ClinVar
NCI-TCGA novel	p.Asp520Gly	missense variant	-	NC_000008.11:g.117818508T>C	NCI-TCGA
rs1427879295	p.Pro524Ala	missense variant	-	NC_000008.11:g.117818497G>C	TOPMed
rs1285562876	p.Ala525Thr	missense variant	-	NC_000008.11:g.117818494C>T	TOPMed,gnomAD
rs901022947	p.Lys526Arg	missense variant	-	NC_000008.11:g.117818490T>C	TOPMed,gnomAD
RCV000686425	p.Lys526Ter	nonsense	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117818491T>A	ClinVar
rs751404551	p.Arg528Leu	missense variant	-	NC_000008.11:g.117818484C>A	ExAC,TOPMed,gnomAD
rs761451875	p.Arg528Cys	missense variant	-	NC_000008.11:g.117818485G>A	ExAC,TOPMed,gnomAD
COSM4804148	p.Arg528Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117818484C>G	NCI-TCGA Cosmic
rs751404551	p.Arg528His	missense variant	-	NC_000008.11:g.117818484C>T	ExAC,TOPMed,gnomAD
rs763608530	p.Trp529Cys	missense variant	-	NC_000008.11:g.117818480C>G	ExAC,gnomAD
NCI-TCGA novel	p.Trp529Ter	stop gained	-	NC_000008.11:g.117818480C>T	NCI-TCGA
NCI-TCGA novel	p.Trp529Leu	missense variant	-	NC_000008.11:g.117818481C>A	NCI-TCGA
rs762747719	p.Pro530Arg	missense variant	-	NC_000008.11:g.117818478G>C	ExAC,gnomAD
rs1336890378	p.Ala531Thr	missense variant	-	NC_000008.11:g.117818476C>T	gnomAD
rs1328220647	p.Ala531Asp	missense variant	-	NC_000008.11:g.117818475G>T	gnomAD
rs775110739	p.Ala533Thr	missense variant	-	NC_000008.11:g.117818470C>T	ExAC,gnomAD
rs769496005	p.Val534Leu	missense variant	-	NC_000008.11:g.117818467C>G	ExAC,gnomAD
rs769496005	p.Val534Met	missense variant	-	NC_000008.11:g.117818467C>T	ExAC,gnomAD
COSM6179659	p.Val534Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117818467C>A	NCI-TCGA Cosmic
rs1006713733	p.Pro535Ser	missense variant	-	NC_000008.11:g.117818464G>A	TOPMed
rs144397063	p.Val537Ile	missense variant	-	NC_000008.11:g.117818458C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs767492816	p.Val538Ile	missense variant	-	NC_000008.11:g.117818455C>T	ExAC,TOPMed,gnomAD
rs779357756	p.Ile539Asn	missense variant	-	NC_000008.11:g.117818451A>T	ExAC,gnomAD
rs779357756	p.Ile539Thr	missense variant	-	NC_000008.11:g.117818451A>G	ExAC,gnomAD
COSM117287	p.Ile539Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117818450A>C	NCI-TCGA Cosmic
rs1233420413	p.Ile539Phe	missense variant	-	NC_000008.11:g.117818452T>A	gnomAD
rs1435547768	p.Gly541Arg	missense variant	-	NC_000008.11:g.117818446C>T	gnomAD
rs759528254	p.Lys544Arg	missense variant	-	NC_000008.11:g.117818436T>C	ExAC,TOPMed,gnomAD
rs1368926188	p.Val545Gly	missense variant	-	NC_000008.11:g.117812960A>C	TOPMed,gnomAD
rs1322784502	p.Met546Ile	missense variant	-	NC_000008.11:g.117812956C>T	gnomAD
NCI-TCGA novel	p.Ser548AlaPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.117812952T>-	NCI-TCGA
rs780189656	p.Ser548Gly	missense variant	-	NC_000008.11:g.117812952T>C	ExAC,gnomAD
rs1317388728	p.Arg549His	missense variant	-	NC_000008.11:g.117812948C>T	TOPMed,gnomAD
rs1317388728	p.Arg549Leu	missense variant	-	NC_000008.11:g.117812948C>A	TOPMed,gnomAD
rs770038045	p.Arg549Cys	missense variant	-	NC_000008.11:g.117812949G>A	ExAC,gnomAD
rs745890180	p.Leu551Gln	missense variant	-	NC_000008.11:g.117812942A>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Leu551Val	missense variant	-	NC_000008.11:g.117812943G>C	NCI-TCGA
rs751582814	p.Asp554Asn	missense variant	-	NC_000008.11:g.117812934C>T	ExAC,TOPMed,gnomAD
rs751582814	p.Asp554Tyr	missense variant	-	NC_000008.11:g.117812934C>A	ExAC,TOPMed,gnomAD
rs1392782817	p.Asn555Ile	missense variant	-	NC_000008.11:g.117812930T>A	gnomAD
rs777698557	p.Asn555Asp	missense variant	-	NC_000008.11:g.117812931T>C	ExAC,TOPMed,gnomAD
COSM486002	p.Ile556Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117812928T>A	NCI-TCGA Cosmic
rs561994950	p.Thr558Ala	missense variant	-	NC_000008.11:g.117812922T>C	1000Genomes,ExAC,gnomAD
rs752594306	p.Asp559Glu	missense variant	-	NC_000008.11:g.117812917G>T	ExAC,TOPMed,gnomAD
rs1486918382	p.Ala560Val	missense variant	-	NC_000008.11:g.117812915G>A	gnomAD
rs754680491	p.Ala560Thr	missense variant	-	NC_000008.11:g.117812916C>T	ExAC,gnomAD
rs1345805410	p.Ser563Asn	missense variant	-	NC_000008.11:g.117812906C>T	TOPMed,gnomAD
NCI-TCGA novel	p.Ser563Gly	missense variant	-	NC_000008.11:g.117812907T>C	NCI-TCGA
rs1297906558	p.Leu564Phe	missense variant	-	NC_000008.11:g.117812904G>A	gnomAD
RCV000598655	p.Thr568Ter	frameshift	-	NC_000008.11:g.117812894_117812910dup	ClinVar
rs1361550108	p.Thr568Met	missense variant	-	NC_000008.11:g.117812891G>A	gnomAD
rs1428345482	p.Val569Met	missense variant	-	NC_000008.11:g.117812889C>T	gnomAD
rs1305323658	p.Ser571Leu	missense variant	-	NC_000008.11:g.117812882G>A	TOPMed
NCI-TCGA novel	p.Thr573Ala	missense variant	-	NC_000008.11:g.117812877T>C	NCI-TCGA
RCV000479149	p.Asp576Ter	frameshift	-	NC_000008.11:g.117807373_117807374insA	ClinVar
rs775804762	p.Ala578Thr	missense variant	-	NC_000008.11:g.117807368C>T	ExAC,gnomAD
rs765703551	p.Val581Ala	missense variant	-	NC_000008.11:g.117807358A>G	ExAC,gnomAD
rs575895733	p.Gln583His	missense variant	-	NC_000008.11:g.117807351C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs1309175788	p.Gln583Arg	missense variant	-	NC_000008.11:g.117807352T>C	TOPMed,gnomAD
NCI-TCGA novel	p.Ser584Ile	missense variant	-	NC_000008.11:g.117807349C>A	NCI-TCGA
rs1231316310	p.Glu587Lys	missense variant	-	NC_000008.11:g.117807341C>T	gnomAD
rs1335741663	p.Gly591Ala	missense variant	-	NC_000008.11:g.117807328C>G	gnomAD
rs773446843	p.Tyr592Cys	missense variant	-	NC_000008.11:g.117807325T>C	ExAC,gnomAD
rs1388996809	p.Ala594Thr	missense variant	-	NC_000008.11:g.117807320C>T	TOPMed
rs374887549	p.Ala594Gly	missense variant	-	NC_000008.11:g.117807319G>C	ESP,ExAC,TOPMed,gnomAD
COSM1205857	p.Arg595His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117807316C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg595GlnPheSerTerUnk	frameshift	-	NC_000008.11:g.117807315_117807316GC>-	NCI-TCGA
rs138006768	p.Trp599Gly	missense variant	-	NC_000008.11:g.117807305A>C	ESP,ExAC,TOPMed,gnomAD
rs138006768	p.Trp599Arg	missense variant	-	NC_000008.11:g.117807305A>G	ESP,ExAC,TOPMed,gnomAD
rs372876057	p.Asn601Asp	missense variant	-	NC_000008.11:g.117807299T>C	ESP,ExAC,TOPMed,gnomAD
COSM3896342	p.Ser602Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117807295G>A	NCI-TCGA Cosmic
rs1554657437	p.Glu604Ter	stop gained	-	NC_000008.11:g.117807290C>A	-
RCV000691886	p.Glu604Ter	nonsense	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117807290C>A	ClinVar
RCV000578934	p.Glu604Ter	nonsense	-	NC_000008.11:g.117807290C>A	ClinVar
rs755747479	p.Arg605Pro	missense variant	-	NC_000008.11:g.117807286C>G	ExAC,gnomAD
rs146967463	p.Arg605Trp	missense variant	-	NC_000008.11:g.117807287G>A	ESP,ExAC,TOPMed,gnomAD
rs184475999	p.Ser610Ala	missense variant	-	NC_000008.11:g.117807272A>C	1000Genomes,ExAC,gnomAD
rs753261171	p.Thr613Met	missense variant	-	NC_000008.11:g.117807262G>A	ExAC,gnomAD
rs534809501	p.Thr613Ala	missense variant	-	NC_000008.11:g.117807263T>C	1000Genomes,ExAC,gnomAD
rs1252579899	p.Asp615Asn	missense variant	-	NC_000008.11:g.117807257C>T	gnomAD
rs761025295	p.Val619Ala	missense variant	-	NC_000008.11:g.117807244A>G	ExAC,gnomAD
rs766571771	p.Val619Leu	missense variant	-	NC_000008.11:g.117807245C>A	ExAC,gnomAD
rs766571771	p.Val619Leu	missense variant	-	NC_000008.11:g.117807245C>G	ExAC,gnomAD
NCI-TCGA novel	p.Gly622Ala	missense variant	-	NC_000008.11:g.117807235C>G	NCI-TCGA
COSM346925	p.Ala623Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117807233C>T	NCI-TCGA Cosmic
rs773393953	p.Ile625Val	missense variant	-	NC_000008.11:g.117807227T>C	ExAC,TOPMed,gnomAD
rs886039357	p.Tyr626Ter	stop gained	-	NC_000008.11:g.117807222G>C	-
RCV000254878	p.Tyr626Ter	nonsense	-	NC_000008.11:g.117807222G>C	ClinVar
rs772344042	p.His627Gln	missense variant	-	NC_000008.11:g.117807219G>T	ExAC,TOPMed,gnomAD
VAR_002377	p.His627del	inframe_deletion	Hereditary multiple exostoses 1 (EXT1) [MIM:133700]	-	UniProt
rs1251059183	p.Lys628Arg	missense variant	-	NC_000008.11:g.117807217T>C	TOPMed,gnomAD
NCI-TCGA novel	p.Tyr629Phe	missense variant	-	NC_000008.11:g.117804891T>A	NCI-TCGA
COSM3644538	p.His631Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117804886G>A	NCI-TCGA Cosmic
COSM3698807	p.Tyr632Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.117804881G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ser635Ala	missense variant	-	NC_000008.11:g.117804874A>C	NCI-TCGA
rs760190441	p.Tyr637Asp	missense variant	-	NC_000008.11:g.117804868A>C	TOPMed,gnomAD
COSM1095370	p.Ala640Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117804859C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Asp647Gly	missense variant	-	NC_000008.11:g.117804837T>C	NCI-TCGA
rs761914342	p.Gln648His	missense variant	-	NC_000008.11:g.117804833T>G	ExAC,TOPMed,gnomAD
rs1315338862	p.Ala650Asp	missense variant	-	NC_000008.11:g.117804828G>T	gnomAD
NCI-TCGA novel	p.Asn651Ile	missense variant	-	NC_000008.11:g.117804825T>A	NCI-TCGA
rs1294490923	p.Ile655Val	missense variant	-	NC_000008.11:g.117804814T>C	TOPMed
rs1390390714	p.Met657Ile	missense variant	-	NC_000008.11:g.117804806C>G	TOPMed
rs762841739	p.Phe659Leu	missense variant	-	NC_000008.11:g.117804800G>T	ExAC,TOPMed,gnomAD
rs768587413	p.Phe659Leu	missense variant	-	NC_000008.11:g.117804802A>G	ExAC,gnomAD
rs1335974361	p.Leu660Gln	missense variant	-	NC_000008.11:g.117804798A>T	gnomAD
rs775353874	p.Val661Gly	missense variant	-	NC_000008.11:g.117804795A>C	ExAC,gnomAD
rs775353874	p.Val661Glu	missense variant	-	NC_000008.11:g.117804795A>T	ExAC,gnomAD
rs769638712	p.Ser662Phe	missense variant	-	NC_000008.11:g.117804792G>A	ExAC,gnomAD
rs769638712	p.Ser662Cys	missense variant	-	NC_000008.11:g.117804792G>C	ExAC,gnomAD
COSM3698684	p.Ala663Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117804789G>A	NCI-TCGA Cosmic
RCV000494661	p.Leu667Ter	nonsense	-	NC_000008.11:g.117804777A>T	ClinVar
rs1131692020	p.Leu667Ter	stop gained	-	NC_000008.11:g.117804777A>T	-
rs1290707883	p.Pro668Ser	missense variant	-	NC_000008.11:g.117804775G>A	TOPMed
COSM6179660	p.Pro668Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117804774G>A	NCI-TCGA Cosmic
rs961046001	p.Pro669Leu	missense variant	-	NC_000008.11:g.117804771G>A	TOPMed
RCV000705577	p.Pro669Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117804773del	ClinVar
rs868551404	p.Pro669Ser	missense variant	-	NC_000008.11:g.117804772G>A	TOPMed
rs1006977291	p.Ile670Val	missense variant	-	NC_000008.11:g.117804769T>C	gnomAD
rs1006977291	p.Ile670Phe	missense variant	-	NC_000008.11:g.117804769T>A	gnomAD
rs776200312	p.Gln674Arg	missense variant	-	NC_000008.11:g.117804756T>C	ExAC,gnomAD
NCI-TCGA novel	p.Lys676Glu	missense variant	-	NC_000008.11:g.117804751T>C	NCI-TCGA
COSM421757	p.Tyr678Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117804744T>A	NCI-TCGA Cosmic
RCV000578692	p.Tyr678Ter	nonsense	-	NC_000008.11:g.117804743A>C	ClinVar
rs1554657213	p.Tyr678Ter	stop gained	-	NC_000008.11:g.117804743A>C	-
COSM1095368	p.Glu680Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117804738T>G	NCI-TCGA Cosmic
rs1278931362	p.Met682Thr	missense variant	-	NC_000008.11:g.117804732A>G	gnomAD
rs1340913968	p.Met683Ile	missense variant	-	NC_000008.11:g.117804728C>T	gnomAD
rs1198261263	p.Met683Leu	missense variant	-	NC_000008.11:g.117804730T>A	gnomAD
RCV000630818	p.Ser687Ter	frameshift	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117799895del	ClinVar
rs1282927259	p.Ser687Phe	missense variant	-	NC_000008.11:g.117799893G>A	gnomAD
rs138855109	p.Arg688Trp	missense variant	-	NC_000008.11:g.117799891G>A	ESP,ExAC,TOPMed,gnomAD
rs1336352739	p.Ala689Thr	missense variant	-	NC_000008.11:g.117799888C>T	TOPMed,gnomAD
rs1336352739	p.Ala689Ser	missense variant	-	NC_000008.11:g.117799888C>A	TOPMed,gnomAD
rs746678682	p.Arg691His	missense variant	-	NC_000008.11:g.117799881C>T	ExAC,TOPMed,gnomAD
rs1326876362	p.Ala693Thr	missense variant	-	NC_000008.11:g.117799876C>T	gnomAD
rs1461749491	p.Pro695Thr	missense variant	-	NC_000008.11:g.117799870G>T	gnomAD
rs771535658	p.Asp696Asn	missense variant	-	NC_000008.11:g.117799867C>T	ExAC,gnomAD
COSM748505	p.Phe698Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117799860A>G	NCI-TCGA Cosmic
rs773320520	p.Gln700Lys	missense variant	-	NC_000008.11:g.117799855G>T	gnomAD
rs1363815113	p.Arg701Ter	stop gained	-	NC_000008.11:g.117799852G>A	gnomAD
RCV000630806	p.Arg701Ter	nonsense	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117799852G>A	ClinVar
RCV000579207	p.Arg701Ter	nonsense	-	NC_000008.11:g.117799852G>A	ClinVar
rs1554656266	p.Gln702Ter	stop gained	-	NC_000008.11:g.117799849G>A	-
RCV000630815	p.Gln702Ter	nonsense	Multiple congenital exostosis (EXT1)	NC_000008.11:g.117799849G>A	ClinVar
rs1287294447	p.Met705Val	missense variant	-	NC_000008.11:g.117799840T>C	TOPMed
rs756718693	p.Thr707Met	missense variant	-	NC_000008.11:g.117799833G>A	ExAC
rs905281147	p.Ala709Ser	missense variant	-	NC_000008.11:g.117799828C>A	gnomAD
rs1451386410	p.Ser710Gly	missense variant	-	NC_000008.11:g.117799825T>C	gnomAD
rs786205593	p.Trp711Ter	stop gained	-	NC_000008.11:g.117799821C>T	-
RCV000171418	p.Trp711Ter	nonsense	-	NC_000008.11:g.117799821C>T	ClinVar
rs575830428	p.Phe712Leu	missense variant	-	NC_000008.11:g.117799819A>G	1000Genomes,gnomAD
rs1225915837	p.Met715Val	missense variant	-	NC_000008.11:g.117799810T>C	TOPMed,gnomAD
rs1225915837	p.Met715Leu	missense variant	-	NC_000008.11:g.117799810T>G	TOPMed,gnomAD
rs781722411	p.Pro716Leu	missense variant	-	NC_000008.11:g.117799806G>A	ExAC,gnomAD
COSM1454470	p.Pro716Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117799807G>T	NCI-TCGA Cosmic
rs751787859	p.His719Leu	missense variant	-	NC_000008.11:g.117799797T>A	ExAC,gnomAD
rs751787859	p.His719Pro	missense variant	-	NC_000008.11:g.117799797T>G	ExAC,gnomAD
rs1364578501	p.His719Asp	missense variant	-	NC_000008.11:g.117799798G>C	gnomAD
rs751787859	p.His719Arg	missense variant	-	NC_000008.11:g.117799797T>C	ExAC,gnomAD
rs1373349863	p.Ser720Cys	missense variant	-	NC_000008.11:g.117799794G>C	gnomAD
rs764391436	p.Gln721Ter	stop gained	-	NC_000008.11:g.117799792G>A	ExAC,gnomAD
NCI-TCGA novel	p.Gln721Arg	missense variant	-	NC_000008.11:g.117799791T>C	NCI-TCGA
rs758347621	p.Leu724Pro	missense variant	-	NC_000008.11:g.117799782A>G	ExAC,TOPMed,gnomAD
rs765113358	p.Asp725Asn	missense variant	-	NC_000008.11:g.117799780C>T	ExAC,gnomAD
rs146096724	p.Val727Ile	missense variant	-	NC_000008.11:g.117799774C>T	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Lys730ThrPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.117799764_117799765insG	NCI-TCGA
COSM1095367	p.Asp731Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.117799762C>A	NCI-TCGA Cosmic
rs1188494289	p.Gln732Arg	missense variant	-	NC_000008.11:g.117799758T>C	gnomAD
rs200106029	p.Ile735Val	missense variant	-	NC_000008.11:g.117799750T>C	TOPMed,gnomAD
COSM5062850	p.Arg741Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000008.11:g.117799732G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Asp742Tyr	missense variant	-	NC_000008.11:g.117799729C>A	NCI-TCGA
rs1477526677	p.Ile743Val	missense variant	-	NC_000008.11:g.117799726T>C	TOPMed,gnomAD
rs756691505	p.Arg745Ter	stop gained	-	NC_000008.11:g.117799720G>A	TOPMed

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0001956	Alcohol Use Disorder	disease	BEFREE
C0001973	Alcoholic Intoxication, Chronic	disease	BEFREE
C0003431	Antisocial Personality Disorder	disease	BEFREE
C0003873	Rheumatoid Arthritis	disease	BEFREE
C0004352	Autistic Disorder	group	BEFREE;CTD_human;LHGDN;MGD
C0004364	Autoimmune Diseases	group	BEFREE
C0005940	Bone Diseases	group	BEFREE
C0005967	Bone neoplasms	group	BEFREE
C0007113	Rectal Carcinoma	disease	BEFREE
C0008441	Chondroblastoma	disease	BEFREE
C0008479	Chondrosarcoma	disease	BEFREE;CLINVAR;CTD_human;HPO;LHGDN;ORPHANET;UNIPROT
C0008626	Congenital chromosomal disease	group	BEFREE
C0011860	Diabetes Mellitus, Non-Insulin-Dependent	disease	BEFREE
C0012691	Dislocations	group	HPO
C0014084	Enchondromatosis	disease	BEFREE
C0015302	External exotoses	disease	BEFREE
C0015306	Hereditary Multiple Exostoses	disease	BEFREE;CLINGEN;CLINVAR;CTD_human;HPO;LHGDN;MGD;ORPHANET;UNIPROT
C0016506	Foot Deformities	group	HPO
C0017638	Glioma	disease	BEFREE
C0019158	Hepatitis	disease	BEFREE
C0019159	Hepatitis A	disease	BEFREE
C0019163	Hepatitis B	disease	BEFREE
C0019189	Hepatitis, Chronic	disease	BEFREE
C0019693	HIV Infections	group	BEFREE
C0020445	Hypercholesterolemia, Familial	disease	BEFREE
C0020492	Hyperostosis	disease	BEFREE
C0023003	Langer-Giedion Syndrome	disease	BEFREE;ORPHANET
C0023418	leukemia	disease	BEFREE
C0023895	Liver diseases	group	BEFREE
C0025362	Mental Retardation	disease	BEFREE;HPO
C0025995	Micromelia	disease	HPO
C0026764	Multiple Myeloma	disease	BEFREE
C0027726	Nephrotic Syndrome	group	LHGDN
C0029423	Cartilaginous exostosis	disease	BEFREE;LHGDN
C0029434	Osteogenesis Imperfecta	disease	GENOMICS_ENGLAND
C0029445	Bone necrosis	phenotype	HPO
C0029456	Osteoporosis	disease	BEFREE
C0029463	Osteosarcoma	disease	BEFREE;CGI
C0038165	Staphylococcal Scalded Skin Syndrome	disease	BEFREE
C0042384	Vasculitis	group	BEFREE
C0042721	Viral hepatitis	group	BEFREE
C0085660	Aseptic necrosis	phenotype	HPO
C0086647	Mucopolysaccharidosis Type IIIA	disease	BEFREE
C0149645	Cervical myelopathy	disease	HPO
C0149654	Conduct Disorder	disease	BEFREE
C0149721	Left Ventricular Hypertrophy	disease	GWASDB
C0151311	Cranial nerve palsies	phenotype	HPO
C0151786	Muscle Weakness	phenotype	HPO
C0151825	Bone pain	phenotype	HPO
C0152441	Madelung Deformity	disease	HPO
C0178874	Tumor Progression	phenotype	BEFREE
C0206085	Kleine-Levin Syndrome	disease	GENOMICS_ENGLAND
C0206641	Osteochondromatosis	disease	BEFREE;ORPHANET
C0206708	Cervical Intraepithelial Neoplasia	disease	BEFREE
C0231246	Failure to gain weight	phenotype	HPO
C0239138	Hip joint varus deformity - observation	phenotype	HPO
C0240543	Bulbous nose	phenotype	HPO
C0262444	Abnormality of the dentition	phenotype	HPO
C0263661	Disorder of skeletal system	group	BEFREE
C0266617	Congenital anomaly of face	group	BEFREE
C0267797	Acute hepatitis	disease	BEFREE
C0275524	Coinfection	phenotype	BEFREE
C0282577	Congenital Disorders of Glycosylation	group	GENOMICS_ENGLAND
C0302809	Fulminant hepatitis	disease	BEFREE
C0341439	Chronic liver disease	group	BEFREE
C0342384	Idiopathic hypogonadotropic hypogonadism	disease	BEFREE
C0349588	Short stature	phenotype	HPO
C0403396	Steroid-sensitive nephrotic syndrome	disease	BEFREE
C0403443	Renal Failure, Progressive, with Hypertension	disease	BEFREE
C0410530	Metachondromatosis	disease	BEFREE
C0410719	Deformity of bone	group	BEFREE
C0423903	Low intelligence	phenotype	HPO
C0432282	Dysplasia epiphysealis hemimelica	disease	BEFREE
C0432482	Fragile X chromosome	disease	BEFREE
C0520474	Aseptic Necrosis of Bone	phenotype	HPO
C0520788	Posttransfusion viral hepatitis	disease	BEFREE
C0541764	Delayed bone age	phenotype	HPO
C0543697	Mixed cryoglobulinemia	disease	BEFREE
C0576093	Knee joint valgus deformity	phenotype	HPO
C0576962	Tooth problem	phenotype	HPO
C0581342	Redundant skin	phenotype	HPO
C0596263	Carcinogenesis	phenotype	BEFREE
C0745103	Hyperlipoproteinemia Type IIa	disease	BEFREE
C0745744	End Stage Liver Disease	disease	BEFREE
C0751356	Idiopathic Inflammatory Myopathies	disease	BEFREE
C0877326	Bone infarction	phenotype	HPO
C0917816	Mental deficiency	disease	HPO
C0936248	Chondroma	disease	BEFREE
C1168401	Squamous cell carcinoma of the head and neck	disease	BEFREE
C1305420	Prominent ear	phenotype	HPO
C1332922	Cervical Squamous Intraepithelial Neoplasia	disease	BEFREE
C1335938	Secondary Chondrosarcoma	disease	BEFREE
C1442903	Exostoses	phenotype	BEFREE
C1611184	Calcification of coronary artery	phenotype	GWASDB
C1834118	Potato nose	phenotype	HPO
C1835579	Rib exostoses	phenotype	HPO
C1835583	Multiple long-bone exostoses	phenotype	HPO
C1837084	Short metacarpal	phenotype	HPO
C1839797	Deep philtrum	phenotype	HPO
C1840077	Anteverted nostril	phenotype	HPO
C1843367	Poor school performance	phenotype	HPO
C1844689	Pelvic bone exostoses	disease	HPO
C1851413	EXOSTOSES, MULTIPLE, TYPE II	disease	BEFREE
C1851414	Peripheral nerve compression	phenotype	HPO
C1851415	Scapular exostoses	disease	HPO
C1851418	Protuberances at ends of long bones	phenotype	HPO
C1851419	Madelung-like forearm deformities	phenotype	HPO
C1853487	Thick eyebrow	phenotype	HPO
C1855285	Protruding ear	phenotype	HPO
C1855496	Contiguous gene syndrome	disease	BEFREE
C1855751	Bulbous nasal tip	phenotype	HPO
C1857042	Sparse scalp hair	phenotype	HPO
C1857486	Low-set, posteriorly rotated ears	phenotype	HPO
C1859399	Radial bowing	phenotype	HPO
C1859480	Cone-shaped epiphyses of the phalanges of the hand	phenotype	HPO
C1860614	ULNAR HYPOPLASIA	phenotype	HPO
C1862132	Short ulnae	phenotype	HPO
C1865014	Long philtrum	phenotype	HPO
C1865017	Thin upper lip vermilion	phenotype	HPO
C2315100	Pediatric failure to thrive	disease	HPO
C3553764	Joint hyperflexibility	phenotype	HPO
C3714756	Intellectual Disability	group	BEFREE;GENOMICS_ENGLAND;HPO
C4020861	Depressed philtrum	phenotype	HPO
C4020876	Dull intelligence	phenotype	HPO
C4021742	Abnormality of the humerus	phenotype	HPO
C4021750	Abnormality of femur morphology	phenotype	HPO
C4021790	Abnormality of the skeletal system	phenotype	BEFREE
C4024589	Aplasia/Hypoplasia of the mandible	phenotype	HPO
C4025663	Abnormality of tibia morphology	phenotype	HPO
C4025814	Abnormality of the metaphysis	phenotype	HPO
C4054043	Secondary Peripheral Chondrosarcoma	disease	BEFREE
C4531021	Undergrowth	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0008375	acetylglucosaminyltransferase activity	IDA
GO:0008375	acetylglucosaminyltransferase activity	IBA
GO:0015020	glucuronosyltransferase activity	IDA
GO:0015020	glucuronosyltransferase activity	IBA
GO:0016757	transferase activity, transferring glycosyl groups	IDA
GO:0016757	transferase activity, transferring glycosyl groups	IBA
GO:0042328	heparan sulfate N-acetylglucosaminyltransferase activity	NAS
GO:0042803	protein homodimerization activity	IDA
GO:0046872	metal ion binding	IEA
GO:0046982	protein heterodimerization activity	IPI
GO:0050508	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity	ISS
GO:0050508	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity	NAS
GO:0050509	N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity	ISS
GO:0050509	N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity	NAS

GO:Biological Process

GO ID	GO Term	Evidence
GO:0001501	skeletal system development	TAS
GO:0001503	ossification	IMP
GO:0006024	glycosaminoglycan biosynthetic process	IDA
GO:0006024	glycosaminoglycan biosynthetic process	TAS
GO:0006486	protein glycosylation	IEA
GO:0007165	signal transduction	TAS
GO:0007369	gastrulation	IEA
GO:0007411	axon guidance	IEA
GO:0007492	endoderm development	IEA
GO:0007498	mesoderm development	IEA
GO:0015012	heparan sulfate proteoglycan biosynthetic process	ISS
GO:0015012	heparan sulfate proteoglycan biosynthetic process	IDA
GO:0015014	heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process	IMP
GO:0021772	olfactory bulb development	IEA
GO:0033692	cellular polysaccharide biosynthetic process	IDA
GO:0072498	embryonic skeletal joint development	IEA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0000139	Golgi membrane	TAS
GO:0005783	endoplasmic reticulum	IDA
GO:0005789	endoplasmic reticulum membrane	NAS
GO:0005794	Golgi apparatus	IDA
GO:0005794	Golgi apparatus	IBA
GO:0016021	integral component of membrane	TAS
GO:0030176	integral component of endoplasmic reticulum membrane	ISS

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-1430728	Metabolism	TAS
R-HSA-1630316	Glycosaminoglycan metabolism	TAS
R-HSA-1638091	Heparan sulfate/heparin (HS-GAG) metabolism	TAS
R-HSA-1643685	Disease	TAS
R-HSA-2022928	HS-GAG biosynthesis	TAS
R-HSA-3560782	Diseases associated with glycosaminoglycan metabolism	TAS
R-HSA-3656237	Defective EXT2 causes exostoses 2	TAS
R-HSA-3656253	Defective EXT1 causes exostoses 1, TRPS2 and CHDS	TAS
R-HSA-3781865	Diseases of glycosylation	TAS
R-HSA-71387	Metabolism of carbohydrates	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
D020001	1-Butanol	[[Gasoline co-treated with 1-Butanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of EXT1 mRNA	29432896
C111118	2',3,3',4',5-pentachloro-4-hydroxybiphenyl	2',3,3',4',5-pentachloro-4-hydroxybiphenyl results in decreased expression of EXT1 mRNA	19114083
C029497	2,3-bis(3'-hydroxybenzyl)butyrolactone	2,3-bis(3'-hydroxybenzyl)butyrolactone results in decreased expression of EXT1 mRNA	19167446
C029497	2,3-bis(3'-hydroxybenzyl)butyrolactone	[Coumestrol co-treated with 2,3-bis(3'-hydroxybenzyl)butyrolactone] results in decreased expression of EXT1 mRNA	19167446
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EXT1 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EXT1 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EXT1 mRNA	27188386
D015123	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide affects the expression of EXT1 mRNA	20382639
D015123	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide results in decreased expression of EXT1 mRNA	19150397
C553817	7-(benzylamino)-1,3,4,8-tetrahydropyrrolo(4,3,2-de)quinolin-8(1H)-one	7-(benzylamino)-1,3,4,8-tetrahydropyrrolo(4,3,2-de)quinolin-8(1H)-one results in increased expression of EXT1 mRNA	19936915
C496492	abrine	abrine results in increased expression of EXT1 mRNA	31054353
D000082	Acetaminophen	Acetaminophen results in decreased expression of EXT1 mRNA	21420995
D000082	Acetaminophen	Acetaminophen results in increased expression of EXT1 mRNA	29067470
D000082	Acetaminophen	Acetaminophen affects the expression of EXT1 mRNA	17562736
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased methylation of EXT1 gene	27153756
D001151	Arsenic	Arsenic affects the methylation of EXT1 gene	25304211
D001280	Atrazine	Atrazine results in increased expression of EXT1 mRNA	22378314
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of EXT1 mRNA	20064835; 20106945; 21632981;
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of EXT1 mRNA	19770486
C006780	bisphenol A	bisphenol A results in increased expression of EXT1 mRNA	29275510
C006780	bisphenol A	bisphenol A results in increased expression of EXT1 mRNA	21932408
C006780	bisphenol A	bisphenol A results in increased expression of EXT1 mRNA	25181051; 30816183;
C054133	casticin	casticin results in increased expression of EXT1 mRNA	28444820
D002945	Cisplatin	[Cisplatin co-treated with jinfukang] results in decreased expression of EXT1 mRNA	27392435
D002945	Cisplatin	Cisplatin results in decreased expression of EXT1 mRNA	19561079
C018021	cobaltous chloride	cobaltous chloride results in decreased expression of EXT1 mRNA	19320972
D019327	Copper Sulfate	Copper Sulfate results in increased expression of EXT1 mRNA	19549813
D003367	Cotinine	Cotinine affects the methylation of EXT1 gene	22851337
D003375	Coumestrol	[Coumestrol co-treated with 2,3-bis(3'-hydroxybenzyl)butyrolactone] results in decreased expression of EXT1 mRNA	19167446
D003375	Coumestrol	Coumestrol results in decreased expression of EXT1 mRNA	19167446
D003471	Cuprizone	Cuprizone results in decreased expression of EXT1 mRNA	26577399
D016572	Cyclosporine	Cyclosporine results in decreased expression of EXT1 mRNA	27989131
D003993	Dibutyl Phthalate	Dibutyl Phthalate results in increased expression of EXT1 mRNA	21266533
C121718	dicyclanil	dicyclanil results in increased expression of EXT1 mRNA	15664270
D004041	Dietary Fats	Dietary Fats results in decreased expression of EXT1 mRNA	18042831; 25016146;
D004041	Dietary Fats	Dietary Fats results in increased expression of EXT1 mRNA	18042831
D004237	Diuron	Diuron results in decreased expression of EXT1 mRNA	25152437
C516138	dorsomorphin	[NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EXT1 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EXT1 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EXT1 mRNA	27188386
D004317	Doxorubicin	Doxorubicin results in decreased expression of EXT1 mRNA	19073829
D004726	Endosulfan	Endosulfan results in decreased expression of EXT1 mRNA	29391264
D004958	Estradiol	Estradiol results in decreased expression of EXT1 mRNA	19167446
D000431	Ethanol	Ethanol affects the expression of and affects the splicing of EXT1 mRNA	30319688
D004997	Ethinyl Estradiol	[Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of EXT1 mRNA	17942748
D017313	Fenretinide	Fenretinide results in decreased expression of EXT1 mRNA	28973697
D005557	Formaldehyde	Formaldehyde results in decreased expression of EXT1 mRNA	20655997
C546771	gardiquimod	gardiquimod results in increased expression of EXT1 mRNA	28003376
C546771	gardiquimod	Protein Kinase Inhibitors inhibits the reaction [gardiquimod results in increased expression of EXT1 mRNA]	28003376
D005742	Gasoline	[[Gasoline co-treated with 1-Butanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of EXT1 mRNA	29432896
D005839	Gentamicins	Gentamicins results in increased expression of EXT1 mRNA	22061828
D015759	Ionomycin	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in decreased expression of EXT1 mRNA	25613284
C544151	jinfukang	[Cisplatin co-treated with jinfukang] results in decreased expression of EXT1 mRNA	27392435
C410337	K 7174	K 7174 results in increased expression of EXT1 mRNA	24086573
D048628	Ketolides	Ketolides analog results in decreased expression of EXT1 mRNA	24967691
D000077339	Leflunomide	Leflunomide results in increased expression of EXT1 mRNA	28988120
C008493	methylselenic acid	methylselenic acid results in increased expression of EXT1 mRNA	18548127
C000627226	momfluorothrin	momfluorothrin results in increased expression of EXT1 mRNA	28520973
D037742	Nanotubes, Carbon	Nanotubes, Carbon analog results in increased expression of EXT1 mRNA	25554681
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in increased expression of EXT1 mRNA	25554681
C012655	nimesulide	nimesulide results in decreased expression of EXT1 mRNA	24136188
C507134	ON 01910	ON 01910 results in increased expression of EXT1 mRNA	22351695
D000077150	Oxaliplatin	[Oxaliplatin co-treated with Topotecan] results in decreased expression of EXT1 mRNA	25729387
D000073878	Palm Oil	Palm Oil results in decreased expression of EXT1 mRNA	18042831
D000073878	Palm Oil	Palm Oil results in increased expression of EXT1 mRNA	18042831
D000077767	Panobinostat	[NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EXT1 mRNA	27188386
D000077767	Panobinostat	Panobinostat results in decreased expression of EXT1 mRNA	26272509
D052638	Particulate Matter	[[Gasoline co-treated with 1-Butanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of EXT1 mRNA	29432896
C568608	PCI 5002	[PCI 5002 co-treated with Zinc] results in increased expression of EXT1 mRNA	18593933
D011084	Polycyclic Aromatic Hydrocarbons	[[Gasoline co-treated with 1-Butanol] results in increased chemical synthesis of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of EXT1 mRNA	29432896
D011374	Progesterone	Progesterone results in increased expression of EXT1 mRNA	19690047
D047428	Protein Kinase Inhibitors	Protein Kinase Inhibitors inhibits the reaction [gardiquimod results in increased expression of EXT1 mRNA]	28003376
C010327	salinomycin	salinomycin results in decreased expression of EXT1 mRNA	19682730
D012643	Selenium	[Selenium co-treated with Vitamin E] results in increased expression of EXT1 mRNA	19244175
C017947	sodium arsenite	sodium arsenite results in increased expression of EXT1 mRNA	12634122
D012999	Soman	Soman results in increased expression of EXT1 mRNA	19281266
D000077210	Sunitinib	Sunitinib results in increased expression of EXT1 mRNA	31533062
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of EXT1 mRNA	21570461; 24680724;
D013749	Tetrachlorodibenzodioxin	[Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of EXT1 mRNA	17942748
D013755	Tetradecanoylphorbol Acetate	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in decreased expression of EXT1 mRNA	25613284
D019772	Topotecan	[Oxaliplatin co-treated with Topotecan] results in decreased expression of EXT1 mRNA	25729387
D019772	Topotecan	Topotecan results in decreased expression of EXT1 mRNA	25729387
C012589	trichostatin A	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EXT1 mRNA	27188386
C012589	trichostatin A	trichostatin A results in decreased expression of EXT1 mRNA	24935251; 26272509;
D014520	Urethane	Urethane results in increased expression of EXT1 mRNA	28818685
D014635	Valproic Acid	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EXT1 mRNA	27188386
D014635	Valproic Acid	Valproic Acid results in decreased expression of EXT1 mRNA	23179753; 24383497; 24935251; 26272509;
D014635	Valproic Acid	Valproic Acid results in decreased methylation of EXT1 gene	29154799
D014635	Valproic Acid	Valproic Acid results in increased expression of EXT1 mRNA	23179753; 28001369;
D001335	Vehicle Emissions	Vehicle Emissions results in decreased methylation of EXT1 gene	25560391
D014750	Vincristine	Vincristine results in increased expression of EXT1 mRNA	23649840
D014810	Vitamin E	[Selenium co-treated with Vitamin E] results in increased expression of EXT1 mRNA	19244175
D014810	Vitamin E	Vitamin E results in increased expression of EXT1 mRNA	19244175
D014874	Water Pollutants, Chemical	Water Pollutants, Chemical results in decreased expression of EXT1 mRNA	22899542
D015032	Zinc	[PCI 5002 co-treated with Zinc] results in increased expression of EXT1 mRNA	18593933

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0225	Disease mutation
KW-1015	Disulfide bond
KW-0256	Endoplasmic reticulum
KW-0325	Glycoprotein
KW-0328	Glycosyltransferase
KW-0333	Golgi apparatus
KW-0361	Hereditary multiple exostoses
KW-0464	Manganese
KW-0472	Membrane
KW-0479	Metal-binding
KW-1185	Reference proteome
KW-0735	Signal-anchor
KW-0808	Transferase
KW-0812	Transmembrane
KW-1133	Transmembrane helix
KW-0043	Tumor suppressor

Interpro

InterPro ID	InterPro Term
IPR004263	Exostosin
IPR027670	Exostosin-1
IPR040911	Exostosin_GT47
IPR015338	GT64
IPR029044	Nucleotide-diphossugar_trans

PROSITE

PROSITE ID	PROSITE Term

Pfam

Pfam ID	Pfam Term
PF03016	Exostosin
PF09258	Glyco_transf_64

Gene: EXT1

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction