| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406881 |
Name | MIRLET7A1 |
Synonym | LET7A1|MIRNLET7A1|let-7a-1;microRNA let-7a-1;MIRLET7A1;microRNA let-7a-1 |
Definition | - |
Position | 9q22.32 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIRLET7A1 | |
|
External Links |
|
Links to Entrez Gene | 406881 |
Links to all GeneRIF Items | 406881 |
Links to iHOP | 406881 |
|
Sequence Information |
|
Nucleotide Sequence |
>406881 : length: 22 tgaggtagtaggttgtatagtt |
Protein Sequence |
>406881 : length: 3 N/A |