| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406881 |
Name | MIRLET7A1 |
Synonym | LET7A1|MIRNLET7A1|let-7a-1;microRNA let-7a-1;MIRLET7A1;microRNA let-7a-1 |
Definition | - |
Position | 9q22.32 |
Gene Type | miscRNA |
PAH Type | Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIRLET7A1 | |
External Links | |
Links to Entrez Gene | 406881 |
Links to all GeneRIF Items | 406881 |
Links to iHOP | 406881 |
Sequence Information | |
Nucleotide Sequence | >406881 : length: 22 tgaggtagtaggttgtatagtt |
Protein Sequence | >406881 : length: 3 N/A |