| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406991 |
Name | MIR21 |
Synonym | MIRN21|hsa-mir-21|miR-21|miRNA21;microRNA 21;MIR21;microRNA 21 |
Definition | - |
Position | 17q23.1 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PAH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
PH | A network-based bioinformatic approach coupled with confirmatory in vivo data delineates a central regulatory role for miR-21 in pulmonary hypertension. |
| More detail of all Human literatures about MIR21 | |
|
External Links |
|
Links to Entrez Gene | 406991 |
Links to all GeneRIF Items | 406991 |
Links to iHOP | 406991 |
|
Sequence Information |
|
Nucleotide Sequence |
>406991 : length: 22 tagcttatcagactgatgttga |
Protein Sequence |
>406991 : length: 3 N/A |