Gene Page: TOM1
Summary ?
| GeneID | 10043 |
| Symbol | TOM1 |
| Synonyms | - |
| Description | target of myb1 membrane trafficking protein |
| Reference | MIM:604700|HGNC:HGNC:11982|Ensembl:ENSG00000100284|HPRD:05265|Vega:OTTHUMG00000150958 |
| Gene type | protein-coding |
| Map location | 22q13.1 |
| Pascal p-value | 0.58 |
| Sherlock p-value | 0.279 |
| Fetal beta | -1.747 |
| DMG | 2 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
| DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 2 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg05531055 | 22 | 35695625 | TOM1 | -0.027 | 0.29 | DMG:Nishioka_2013 | |
| cg05531055 | 22 | 35695625 | TOM1 | 8.06E-8 | -0.011 | 1.88E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SFRS9 | 0.95 | 0.93 |
| RANBP1 | 0.93 | 0.89 |
| AC026691.1 | 0.92 | 0.90 |
| RNASEH2A | 0.92 | 0.92 |
| DDX39 | 0.91 | 0.90 |
| BAT4 | 0.91 | 0.89 |
| H2AFY | 0.91 | 0.90 |
| U2AF1 | 0.91 | 0.89 |
| SNRPF | 0.90 | 0.85 |
| SFRS3 | 0.90 | 0.92 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.33 | -0.69 | -0.85 |
| AF347015.27 | -0.68 | -0.83 |
| MT-CO2 | -0.68 | -0.82 |
| HLA-F | -0.68 | -0.77 |
| AF347015.31 | -0.68 | -0.81 |
| MT-CYB | -0.67 | -0.83 |
| AF347015.15 | -0.66 | -0.85 |
| AF347015.8 | -0.66 | -0.83 |
| AF347015.2 | -0.65 | -0.84 |
| AF347015.9 | -0.64 | -0.84 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 14613930 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006897 | endocytosis | NAS | 10329004 | |
| GO:0006886 | intracellular protein transport | IEA | - | |
| GO:0016197 | endosome transport | NAS | 14613930 | |
| GO:0016197 | endosome transport | TAS | 10329004 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005813 | centrosome | IDA | 18029348 | |
| GO:0005829 | cytosol | IDA | 14613930 | |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0005764 | lysosome | TAS | 10329004 | |
| GO:0005768 | endosome | TAS | 10329004 | |
| GO:0005769 | early endosome | IDA | 14613930 | |
| GO:0016020 | membrane | IDA | 14613930 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID CMYB PATHWAY | 84 | 61 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| CREIGHTON AKT1 SIGNALING VIA MTOR DN | 23 | 16 | All SZGR 2.0 genes in this pathway |
| CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
| JAZAG TGFB1 SIGNALING VIA SMAD4 UP | 108 | 66 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED MODERATELY VS POORLY UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
| WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV NHEK UP | 244 | 151 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
| AGUIRRE PANCREATIC CANCER COPY NUMBER DN | 238 | 145 | All SZGR 2.0 genes in this pathway |
| HOFMANN MYELODYSPLASTIC SYNDROM RISK UP | 24 | 14 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| DAZARD UV RESPONSE CLUSTER G5 | 12 | 8 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-126/126-3p | 539 | 545 | 1A | hsa-miR-126brain | UCGUACCGUGAGUAAUAAUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.