|
|
| GeneID |
10093
|
| Symbol |
ARPC4
|
| Synonyms |
ARC20|MGC13544|p20-Arc
|
| Description |
actin related protein 2/3 complex, subunit 4, 20kDa |
| See related |
HGNC:707|MIM:604226|Ensembl:ENSG00000214021|HPRD:10368| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
3p25.3 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
| ACP1 | 0.86 | 0.83 | | |
| NIPA2 | 0.84 | 0.78 | | |
| EIF2AK1 | 0.84 | 0.79 | | |
| TTRAP | 0.84 | 0.81 | | |
| TRMT12 | 0.84 | 0.80 | | |
| C20orf43 | 0.83 | 0.78 | | |
| PSME3 | 0.83 | 0.80 | | |
| AZI2 | 0.82 | 0.80 | | |
| ATG12 | 0.82 | 0.79 | | |
| HBS1L | 0.82 | 0.79 | | |
Top 10 negatively co-expressed genes | | AF347015.21 | -0.69 | -0.54 | | |
| MT-CO2 | -0.69 | -0.58 | | |
| AF347015.8 | -0.68 | -0.59 | | |
| AF347015.2 | -0.68 | -0.57 | | |
| AF347015.31 | -0.66 | -0.58 | | |
| AF347015.18 | -0.66 | -0.57 | | |
| MT-CYB | -0.66 | -0.57 | | |
| AF347015.33 | -0.65 | -0.56 | | |
| AF347015.26 | -0.64 | -0.56 | | |
| AF347015.15 | -0.64 | -0.58 | | |
|
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005200 | structural constituent of cytoskeleton | TAS | | 9230079 |
| GO:0030674 | protein binding, bridging | TAS | | 11162547 |
| GO:0051015 | actin filament binding | TAS | | 11162547 |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0030041 | actin filament polymerization | IEA | | - |
| GO:0045010 | actin nucleation | TAS | | 11162547 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0042995 | cell projection | IEA | axon (GO term level: 4) | - |
| GO:0005856 | cytoskeleton | IEA | | - |
| GO:0005737 | cytoplasm | IEA | | - |
| GO:0005885 | Arp2/3 protein complex | TAS | | 9230079 |
| |
|
|
| |
|
| miR-149 | 399 | 406 | 1A,m8 | hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|
