Gene Page: KIF20A

Summary
GeneID  10112
Symbol  KIF20A
Synonyms  FLJ21151|MKLP2|RAB6KIFL
Description  kinesin family member 20A
See related  HGNC:9787|MIM:605664|Ensembl:ENSG00000112984|HPRD:09292|
Locus tag  -
Gene type  protein-coding
Map location  5q31
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0032 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003777microtubule motor activityIEA-
GO:0005524ATP bindingIEA-
GO:0005215transporter activityTAS9438855 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007018microtubule-based movementIEA-
GO:0016192vesicle-mediated transportTAS9438855 
GO:0015031protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005794Golgi apparatusTAS9438855 
GO:0005874microtubuleIEA-
GO:0005875microtubule associated complexIEA-
GO:0005654nucleoplasmEXP12939256 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
RAB6ARAB6 | RAB6A' | RAB6BRAB6A, member RAS oncogene family-HPRD,BioGRID9438855 
RAB6B-RAB6B, member RAS oncogene family-HPRD,BioGRID10893188 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-369-3p1451521A,m8hsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-3741461531A,m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.