Gene Page: NCOA2

Summary
GeneID  10499
Symbol  NCOA2
Synonyms  GRIP1|KAT13C|MGC138808|NCoA-2|TIF2
Description  nuclear receptor coactivator 2
See related  HGNC:7669|MIM:601993|HPRD:09066|
Locus tag  -
Gene type  protein-coding
Map location  8q13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005102receptor bindingIEANeurotransmitter (GO term level: 4)-
GO:0004871signal transducer activityIEA-
GO:0003713transcription coactivator activityNAS9430642 
GO:0005509calcium ion bindingIEA-
GO:0016564transcription repressor activityIEA-
GO:0035257nuclear hormone receptor bindingIEA-
GO:0030375thyroid hormone receptor coactivator activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000122negative regulation of transcription from RNA polymerase II promoterIEA-
GO:0006355regulation of transcription, DNA-dependentNAS8670870 
GO:0007165signal transductionIEA-
GO:0030518steroid hormone receptor signaling pathwayIEA-
GO:0045944positive regulation of transcription from RNA polymerase II promoterIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusNAS-
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AHR-aryl hydrocarbon receptorAffinity Capture-WesternBioGRID12024042 
AHR interacts with NCOA2 (TIF2).BIND15641800 
ANKRD11ANCO-1 | LZ16 | T13ankyrin repeat domain 11ANCO-1 interacts with TIF2. This interaction was modeled on a demonstrated interaction between human ANCO-1 and TIF2 from an unspecified species.BIND15184363 
-HPRD,BioGRID15184363 
ARAIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFMandrogen receptorAffinity Capture-Western
Protein-peptide
Reconstituted Complex
Two-hybrid
BioGRID12612084 |12810069 
|14593076 |14966121 
GRIP1 interacts with AR. This interaction was modeled on a demonstrated interaction between mouse GRIP1 and human AR.BIND10454563 
-HPRD9717843 
-HPRD9717843 |12588987 
ARNTHIF-1beta | HIF1B | HIF1BETA | TANGO | bHLHe2aryl hydrocarbon receptor nuclear translocator-HPRD,BioGRID12024042 
BRCA1BRCAI | BRCC1 | IRIS | PSCP | RNF53breast cancer 1, early onsetProtein-peptide
Reconstituted Complex
BioGRID11085509 |14578343 
CCNT1CCNT | CYCT1cyclin T1Cyclin T1 interacts with GRIP1.BIND11704662 
EP300KAT3B | p300E1A binding protein p300GRIP1 interacts with p300. This interaction was modeled on a demonstrated interaction between mouse GRIP1 and human p300.BIND9920895 
ESR1DKFZp686N23123 | ER | ESR | ESRA | Era | NR3A1estrogen receptor 1ER alpha interacts with TIF2. This interaction was modeled on a demonstrated interaction between TIF2 from an unspecified source and human ER alpha.BIND10706629 
-HPRD,BioGRID11937504 
ESRRBDFNB35 | ERR2 | ERRb | ERRbeta | ERRbeta-2 | ESRL2 | NR3B2estrogen-related receptor betaReconstituted ComplexBioGRID10598588 
GMEB1P96PIF | PIF96glucocorticoid modulatory element binding protein 1-HPRD10692587 
HNF4AFLJ39654 | HNF4 | HNF4a7 | HNF4a8 | HNF4a9 | MODY | MODY1 | NR2A1 | NR2A21 | TCF | TCF14hepatocyte nuclear factor 4, alpha-HPRD,BioGRID9812974 
MAGEA11MAGE-11 | MAGE11 | MAGEA-11 | MGC10511melanoma antigen family A, 11Affinity Capture-WesternBioGRID15684378 
NCOA1F-SRC-1 | KAT13A | MGC129719 | MGC129720 | NCoA-1 | RIP160 | SRC-1 | SRC1 | bHLHe42nuclear receptor coactivator 1Affinity Capture-MS
in vitro
BioGRID11514567 |11971985 
NCOA3ACTR | AIB-1 | AIB1 | CAGH16 | CTG26 | KAT13B | MGC141848 | RAC3 | SRC3 | TNRC14 | TNRC16 | TRAM-1 | pCIPnuclear receptor coactivator 3Affinity Capture-MSBioGRID11971985 
NKX2-1BCH | BHC | NK-2 | NKX2.1 | NKX2A | TEBP | TITF1 | TTF-1 | TTF1NK2 homeobox 1Two-hybridBioGRID10617585 
NR3C1GCCR | GCR | GR | GRLnuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)-HPRD,BioGRID12151000 
GR-alpha interacts with GRIP1.BIND11704662 
PPARGNR1C3 | PPARG1 | PPARG2 | PPARgammaperoxisome proliferator-activated receptor gamma-HPRD,BioGRID10944516 
PPFIA1FLJ41337 | FLJ42630 | FLJ43474 | LIP.1 | LIP1 | LIPRIN | MGC26800protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1-HPRD,BioGRID11931740 
PPFIA4-protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4Reconstituted Complex
Two-hybrid
BioGRID11931740 
PRMT1ANM1 | HCP1 | HRMT1L2 | IR1B4protein arginine methyltransferase 1-HPRD,BioGRID11050077 
RARANR1B1 | RARretinoic acid receptor, alphaGRIP1 interacts with RAR. This interaction was modeled on a demonstrated interaction between mouse GRIP1 and human RAR.BIND9920895 
RORADKFZp686M2414 | MGC119326 | MGC119329 | NR1F1 | ROR1 | ROR2 | ROR3 | RZR-ALPHA | RZRARAR-related orphan receptor A-HPRD10478845 
RXRAFLJ00280 | FLJ00318 | FLJ16020 | FLJ16733 | MGC102720 | NR2B1retinoid X receptor, alphaGRIP1 interacts with RXR. This interaction was modeled on a demonstrated interaction between mouse GRIP1 and human RXR.BIND9920895 
Reconstituted Complex
Two-hybrid
BioGRID11851396 |12612084 
SRCAPDOMO1 | EAF1 | FLJ44499 | KIAA0309 | SWR1Snf2-related CREBBP activator protein-HPRD14500758 
THRBERBA-BETA | ERBA2 | GRTH | MGC126109 | MGC126110 | NR1A2 | PRTH | THR1 | THRB1 | THRB2thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)-HPRD,BioGRID11518802 
GRIP1 interacts with TR. This interaction was modeled on a demonstrated interaction between mouse GRIP1 and human TR.BIND10454563 
VDRNR1I1vitamin D (1,25- dihydroxyvitamin D3) receptorAffinity Capture-Western
Reconstituted Complex
Two-hybrid
BioGRID10748178 |12612084 
|12837248 
GRIP1 interacts with VDR. This interaction was modeled on a demonstrated interaction between mouse GRIP1 and human VDR.BIND9920895 
YWHAHYWHA1tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide-HPRD11266503 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-137124412511A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-1813133201A,m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-18615351541m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-199379385m8hsa-miR-199aCCCAGUGUUCAGACUACCUGUUC
hsa-miR-199bCCCAGUGUUUAGACUAUCUGUUC
miR-200bc/429133713441A,m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-330391397m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-44814891495m8hsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.