Gene Page: CEBPB

Summary
GeneID  1051
Symbol  CEBPB
Synonyms  C/EBP-beta|CRP2|IL6DBP|LAP|MGC32080|NF-IL6|TCF5
Description  CCAAT/enhancer binding protein (C/EBP), beta
See related  HGNC:1834|MIM:189965|Ensembl:ENSG00000172216|HPRD:01801|
Locus tag  -
Gene type  protein-coding
Map location  20q13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
TACC30.960.73
GTSE10.960.77
FAM64A0.960.77
CDCA30.960.73
PLK10.960.73
AC087645.20.960.78
KIF20A0.960.77
KIF2C0.960.76
UBE2C0.950.79
BIRC50.950.78
Top 10 negatively co-expressed genes
C5orf53-0.40-0.64
HLA-F-0.40-0.65
FBXO2-0.40-0.60
PTH1R-0.39-0.59
SLC9A3R2-0.38-0.44
AIFM3-0.38-0.58
ALDOC-0.38-0.61
AF347015.27-0.38-0.70
ASPHD1-0.38-0.53
PTGDS-0.38-0.65
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityNAS10821850 
GO:0016563transcription activator activityIEA-
GO:0042803protein homodimerization activityIEA-
GO:0046982protein heterodimerization activityIEA-
GO:0043565sequence-specific DNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0030182neuron differentiationIEAneuron (GO term level: 8)-
GO:0001892embryonic placenta developmentIEA-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006366transcription from RNA polymerase II promoterTAS10821850 
GO:0006917induction of apoptosisIEA-
GO:0006955immune responseTAS2112087 
GO:0006954inflammatory responseTAS2112087 
GO:0006953acute-phase responseTAS2112087 
GO:0006916anti-apoptosisIEA-
GO:0045941positive regulation of transcriptionIEA-
GO:0045408regulation of interleukin-6 biosynthetic processIEA-
GO:0045444fat cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusTAS10821850 
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARAIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFMandrogen receptorReconstituted ComplexBioGRID9817600 
ATF2CRE-BP1 | CREB2 | HB16 | MGC111558 | TREB7activating transcription factor 2-HPRD9139739 
ATF4CREB-2 | CREB2 | TAXREB67 | TXREBactivating transcription factor 4 (tax-responsive enhancer element B67)-HPRD11018027 
CDK8K35 | MGC126074 | MGC126075cyclin-dependent kinase 8Affinity Capture-WesternBioGRID14759369 
CEBPAC/EBP-alpha | CEBPCCAAT/enhancer binding protein (C/EBP), alpha-HPRD,BioGRID1840554 
CEBPDC/EBP-delta | CELF | CRP3 | NF-IL6-betaCCAAT/enhancer binding protein (C/EBP), delta-HPRD,BioGRID1840554 
CEBPGGPE1BP | IG/EBP-1CCAAT/enhancer binding protein (C/EBP), gamma-HPRD,BioGRID12177065 
CREB1CREB | MGC9284cAMP responsive element binding protein 1-HPRD,BioGRID12773552 
DDIT3CEBPZ | CHOP | CHOP10 | GADD153 | MGC4154DNA-damage-inducible transcript 3DDIT3 (CHOP) interacts with CEBPB (NF-IL6).BIND15775988 
-HPRD1547942 
Affinity Capture-Western
Reconstituted Complex		BioGRID8662954 |12706815 
EGFRERBB | ERBB1 | HER1 | PIG61 | mENAepidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)-HPRD,BioGRID12095417 
EGR1AT225 | G0S30 | KROX-24 | NGFI-A | TIS8 | ZIF-268 | ZNF225early growth response 1-HPRD,BioGRID12947119 
Egr1 interacts with c/EBP-beta. This interaction was modeled on a demonstrated interaction between mouse Egr1 and human c/EBP-beta.BIND12947119 
ELK1-ELK1, member of ETS oncogene family-HPRD1547942 
EP300KAT3B | p300E1A binding protein p300-HPRD,BioGRID9343424 
ESR1DKFZp686N23123 | ER | ESR | ESRA | Era | NR3A1estrogen receptor 1-HPRD,BioGRID7651415 
FOXO1FKH1 | FKHR | FOXO1Aforkhead box O1-HPRD,BioGRID11893744 
HMGA1HMG-R | HMGA1A | HMGIY | MGC12816 | MGC4242 | MGC4854high mobility group AT-hook 1-HPRD,BioGRID12665574 
HNRNPKCSBP | FLJ41122 | HNRPK | TUNPheterogeneous nuclear ribonucleoprotein K-HPRD,BioGRID9553145 
HSF1HSTF1heat shock transcription factor 1-HPRD,BioGRID11801594 
MAPK1ERK | ERK2 | ERT1 | MAPK2 | P42MAPK | PRKM1 | PRKM2 | p38 | p40 | p41 | p41mapkmitogen-activated protein kinase 1Biochemical ActivityBioGRID11500490 
MED23CRSP130 | CRSP133 | CRSP3 | DKFZp434H0117 | DRIP130 | SUR2mediator complex subunit 23-HPRD,BioGRID14759369 
MED26CRSP7 | CRSP70mediator complex subunit 26Affinity Capture-WesternBioGRID14759369 
MYBCmyb | c-myb | c-myb_CDS | efgv-myb myeloblastosis viral oncogene homolog (avian)-HPRD,BioGRID11792321 
MYCbHLHe39 | c-Mycv-myc myelocytomatosis viral oncogene homolog (avian)-HPRD,BioGRID12873812 
NFKB1DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105nuclear factor of kappa light polypeptide gene enhancer in B-cells 1-HPRD,BioGRID1518839 
NOLC1KIAA0035 | NOPP130 | NOPP140 | NS5ATP13 | P130nucleolar and coiled-body phosphoprotein 1-HPRD,BioGRID8972203 |9553145 
NR3C1GCCR | GCR | GR | GRLnuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)-HPRD,BioGRID9817600 
PRG2BMPG | MBP | MBP1 | MGC14537proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)The MBP-P2 promoter interacts with C/EBP-beta.BIND12202480 
RARBHAP | NR1B2 | RRB2retinoic acid receptor, betaReconstituted ComplexBioGRID9817600 
RB1OSRC | RB | p105-Rb | pRb | pp110retinoblastoma 1-HPRD,BioGRID11596110 
RELAMGC131774 | NFKB3 | p65v-rel reticuloendotheliosis viral oncogene homolog A (avian)-HPRD,BioGRID9570146 |12707271 
RUNX1AML1 | AML1-EVI-1 | AMLCR1 | CBFA2 | EVI-1 | PEBP2aBrunt-related transcription factor 1-HPRD,BioGRID8622667 
RUNX2AML3 | CBFA1 | CCD | CCD1 | MGC120022 | MGC120023 | OSF2 | PEA2aA | PEBP2A1 | PEBP2A2 | PEBP2aA | PEBP2aA1runt-related transcription factor 2-HPRD11668178 
SMAD3DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396SMAD family member 3-HPRD,BioGRID12524424 
SMAD4DPC4 | JIP | MADH4SMAD family member 4CEBPB (C/EBP-beta) interacts with SMAD4. This interaction was modeled on a demonstrated interaction between CEBPB and SMAD4, both from unspecified species.BIND12202226 
-HPRD,BioGRID12524424 
SMARCA2BAF190 | BRM | FLJ36757 | MGC74511 | SNF2 | SNF2L2 | SNF2LA | SWI2 | Sth1p | hBRM | hSNF2aSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2Affinity Capture-Western
Reconstituted Complex		BioGRID10619021 
SMARCA4BAF190 | BRG1 | FLJ39786 | SNF2 | SNF2-BETA | SNF2L4 | SNF2LB | SWI2 | hSNF2bSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4-HPRD10619021 
SMARCB1BAF47 | INI1 | RDT | SNF5 | SNF5L1 | Sfh1p | Snr1 | hSNFSSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1-HPRD10619021 
SMARCC1BAF155 | CRACC1 | Rsc8 | SRG3 | SWI3SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1-HPRD,BioGRID10619021 
SP1-Sp1 transcription factor-HPRD,BioGRID12847250 
SPI1OF | PU.1 | SFPI1 | SPI-1 | SPI-Aspleen focus forming virus (SFFV) proviral integration oncogene spi1-HPRD,BioGRID7594592 
SRFMCM1serum response factor (c-fos serum response element-binding transcription factor)-HPRD11500490 
Affinity Capture-Western
Reconstituted Complex
Two-hybrid		BioGRID9032301 |10318842 
STAT5AMGF | STAT5signal transducer and activator of transcription 5A-HPRD11158330 
STAT6D12S1644 | IL-4-STAT | STAT6B | STAT6Csignal transducer and activator of transcription 6, interleukin-4 induced-HPRD9712049 
TAF9AD-004 | AK6 | CGI-137 | CINAP | CIP | MGC1603 | MGC3647 | MGC5067 | MGC:1603 | MGC:3647 | MGC:5067 | TAF2G | TAFII31 | TAFII32 | TAFIID32TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa-HPRD10821850 
TRIM28FLJ29029 | KAP1 | RNF96 | TF1B | TIF1Btripartite motif-containing 28-HPRD,BioGRID9742105 |11711437 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1555545611A,m8hsa-miR-155UUAAUGCUAAUCGUGAUAGGGG
miR-191544550m8hsa-miR-191brainCAACGGAAUCCCAAAAGCAGCU
miR-369-3p4834901A,m8hsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-3744844911A,m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-376505511m8hsa-miR-376aAUCAUAGAGGAAAAUCCACGU
hsa-miR-376bAUCAUAGAGGAAAAUCCAUGUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.