Gene Page: MLLT11

Summary
GeneID  10962
Symbol  MLLT11
Synonyms  AF1Q|RP11-316M1.10
Description  myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
See related  HGNC:16997|MIM:604684|Ensembl:ENSG00000213190|HPRD:05251|
Locus tag  -
Gene type  protein-coding
Map location  1q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003674molecular_functionND-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005575cellular_componentND-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-136214220m8hsa-miR-136ACUCCAUUUGUUUUGAUGAUGGA
miR-1851319m8hsa-miR-185brainUGGAGAGAAAGGCAGUUC
miR-29109115m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.