Gene Page: STIP1
Summary ?
GeneID | 10963 |
Symbol | STIP1 |
Synonyms | HEL-S-94n|HOP|IEF-SSP-3521|P60|STI1|STI1L |
Description | stress induced phosphoprotein 1 |
Reference | MIM:605063|HGNC:HGNC:11387|Ensembl:ENSG00000168439|HPRD:05454|Vega:OTTHUMG00000167789 |
Gene type | protein-coding |
Map location | 11q13 |
Pascal p-value | 0.024 |
Sherlock p-value | 0.879 |
Fetal beta | -0.157 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | RNA AND PROTEIN SYNTHESIS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0538 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg05267963 | 11 | 63952891 | STIP1 | 3.51E-11 | -0.019 | 3.6E-7 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs17022908 | chr2 | 38783057 | STIP1 | 10963 | 0.06 | trans | ||
rs7702236 | chr5 | 2603308 | STIP1 | 10963 | 0.18 | trans | ||
rs7706288 | chr5 | 141864248 | STIP1 | 10963 | 0.08 | trans | ||
rs10848708 | chr12 | 2931451 | STIP1 | 10963 | 0.11 | trans | ||
rs2286601 | chr12 | 2932176 | STIP1 | 10963 | 0.11 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
STOX2 | 0.83 | 0.84 |
DOCK3 | 0.81 | 0.88 |
AJAP1 | 0.81 | 0.87 |
C11orf41 | 0.81 | 0.85 |
PLCXD3 | 0.80 | 0.84 |
MYCBP2 | 0.79 | 0.86 |
BTBD9 | 0.79 | 0.86 |
MYO5A | 0.79 | 0.84 |
PCDH1 | 0.79 | 0.86 |
C9orf4 | 0.78 | 0.86 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C1orf54 | -0.45 | -0.60 |
FXYD1 | -0.45 | -0.47 |
AF347015.31 | -0.45 | -0.53 |
HIGD1B | -0.45 | -0.53 |
AP002478.3 | -0.45 | -0.54 |
AF347015.21 | -0.45 | -0.54 |
SAT1 | -0.44 | -0.56 |
C1orf61 | -0.44 | -0.60 |
TLCD1 | -0.44 | -0.45 |
ACSF2 | -0.44 | -0.51 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005488 | binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006950 | response to stress | TAS | 1569099 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005794 | Golgi apparatus | TAS | 1569099 | |
GO:0005634 | nucleus | TAS | 16130169 | |
GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
CDC37 | P50CDC37 | cell division cycle 37 homolog (S. cerevisiae) | - | HPRD | 12437126 |
GAPDH | G3PD | GAPD | MGC88685 | glyceraldehyde-3-phosphate dehydrogenase | Affinity Capture-Western | BioGRID | 12887926 |
HSP90AA1 | FLJ31884 | HSP86 | HSP89A | HSP90A | HSP90N | HSPC1 | HSPCA | HSPCAL1 | HSPCAL4 | HSPN | Hsp89 | Hsp90 | LAP2 | heat shock protein 90kDa alpha (cytosolic), class A member 1 | - | HPRD,BioGRID | 10786835 |
HSPA14 | HSP70-4 | HSP70L1 | MGC131990 | heat shock 70kDa protein 14 | - | HPRD,BioGRID | 10786835 |
HSPA1A | FLJ54303 | FLJ54370 | FLJ54392 | FLJ54408 | FLJ75127 | HSP70-1 | HSP70-1A | HSP70I | HSP72 | HSPA1 | HSPA1B | heat shock 70kDa protein 1A | - | HPRD | 12161444 |
HSPA4 | APG-2 | HS24/P52 | MGC131852 | RY | hsp70 | hsp70RY | heat shock 70kDa protein 4 | Affinity Capture-Western | BioGRID | 9452498 |
NME2 | MGC111212 | NDPK-B | NDPKB | NM23-H2 | NM23B | puf | non-metastatic cells 2, protein (NM23B) expressed in | Affinity Capture-MS | BioGRID | 17353931 |
NPAT | E14 | nuclear protein, ataxia-telangiectasia locus | Affinity Capture-Western | BioGRID | 12887926 |
POU2F1 | OCT1 | OTF1 | POU class 2 homeobox 1 | Affinity Capture-Western | BioGRID | 12887926 |
PRNP | ASCR | CD230 | CJD | GSS | MGC26679 | PRIP | PrP | PrP27-30 | PrP33-35C | PrPc | prion | prion protein | - | HPRD,BioGRID | 12093732 |
PTGES3 | P23 | TEBP | cPGES | prostaglandin E synthase 3 (cytosolic) | - | HPRD | 11809754 |
WDR8 | FLJ20430 | MGC99569 | WD repeat domain 8 | Affinity Capture-MS | BioGRID | 17353931 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PRION DISEASES | 35 | 28 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME L1CAM INTERACTIONS | 86 | 62 | All SZGR 2.0 genes in this pathway |
LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
SOTIRIOU BREAST CANCER GRADE 1 VS 3 UP | 151 | 84 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
PUIFFE INVASION INHIBITED BY ASCITES UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS GREEN UP | 23 | 19 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE UP | 136 | 80 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA DN | 146 | 94 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
BARIS THYROID CANCER UP | 23 | 9 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
DIRMEIER LMP1 RESPONSE LATE UP | 57 | 41 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN | 206 | 136 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
PENG LEUCINE DEPRIVATION DN | 187 | 122 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB MORPHOLINO UP | 205 | 126 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE DN | 245 | 154 | All SZGR 2.0 genes in this pathway |
PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
JIANG AGING HYPOTHALAMUS DN | 40 | 31 | All SZGR 2.0 genes in this pathway |
ZHU CMV ALL UP | 120 | 89 | All SZGR 2.0 genes in this pathway |
ZHU CMV 24 HR UP | 93 | 65 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 12HR UP | 111 | 68 | All SZGR 2.0 genes in this pathway |
VISALA RESPONSE TO HEAT SHOCK AND AGING DN | 14 | 12 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
KONDO PROSTATE CANCER HCP WITH H3K27ME3 | 97 | 72 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
PARK APL PATHOGENESIS UP | 14 | 11 | All SZGR 2.0 genes in this pathway |
HOFMANN MYELODYSPLASTIC SYNDROM LOW RISK DN | 30 | 20 | All SZGR 2.0 genes in this pathway |
HOFMANN MYELODYSPLASTIC SYNDROM RISK UP | 24 | 14 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS UNANNOTATED DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 11 | 103 | 68 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO GONADOTROPHINS UP | 91 | 59 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO FORSKOLIN UP | 90 | 58 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO FORSKOLIN DN | 88 | 68 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 2HR DN | 49 | 33 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-324-3p | 299 | 305 | m8 | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.