Gene Page: C14orf1

Summary
GeneID  11161
Symbol  C14orf1
Synonyms  ERG28|NET51
Description  chromosome 14 open reading frame 1
See related  HGNC:1187|MIM:604576|Ensembl:ENSG00000133935|HPRD:05201|
Locus tag  -
Gene type  protein-coding
Map location  14q24.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.1068 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
FPR10.860.71
FCGR1A0.850.70
HCK0.830.66
SIGLEC100.790.65
NCKAP1L0.780.69
CD680.780.75
FCGR3A0.780.68
CD300A0.770.73
FOLR20.760.68
SASH30.760.58
Top 10 negatively co-expressed genes
AL132868.3-0.29-0.46
MUC5B-0.29-0.46
CD8BP-0.28-0.45
AF347015.27-0.27-0.50
MT-CO2-0.27-0.50
MBP-0.26-0.40
MYH14-0.26-0.43
SLCO1A2-0.26-0.38
AF347015.8-0.26-0.51
AF347015.26-0.26-0.53
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003674molecular_functionND-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016126sterol biosynthetic processIEA-
GO:0008150biological_processND-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005789endoplasmic reticulum membraneIEA-
GO:0005783endoplasmic reticulumIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneNAS10449901 
GO:0030133transport vesicleIDA11256614 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ALDH2ALDH-E2 | ALDHI | ALDM | MGC1806aldehyde dehydrogenase 2 family (mitochondrial)Two-hybridBioGRID16169070 
BAIAP2BAP2 | IRSP53BAI1-associated protein 2Two-hybridBioGRID16169070 
BTBD2-BTB (POZ) domain containing 2Two-hybridBioGRID16169070 
CCDC106HSU79303 | ZNF581coiled-coil domain containing 106Two-hybridBioGRID16169070 
CCL18AMAC-1 | AMAC1 | CKb7 | DC-CK1 | DCCK1 | MIP-4 | PARC | SCYA18chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated)Two-hybridBioGRID16169070 
CDC42CDC42Hs | G25Kcell division cycle 42 (GTP binding protein, 25kDa)Two-hybridBioGRID16169070 
CDK5RAP2C48 | Cep215 | DKFZp686B1070 | DKFZp686D1070 | KIAA1633 | MCPH3CDK5 regulatory subunit associated protein 2Two-hybridBioGRID16169070 
COX17MGC104397 | MGC117386COX17 cytochrome c oxidase assembly homolog (S. cerevisiae)Two-hybridBioGRID16169070 
CRADDMGC9163 | RAIDDCASP2 and RIPK1 domain containing adaptor with death domainTwo-hybridBioGRID16169070 
CREB1CREB | MGC9284cAMP responsive element binding protein 1Two-hybridBioGRID16169070 
CSTF2CstF-64cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDaTwo-hybridBioGRID16169070 
DYNLL1DLC1 | DLC8 | DNCL1 | DNCLC1 | LC8 | LC8a | MGC126137 | MGC126138 | PIN | hdlc1dynein, light chain, LC8-type 1Two-hybridBioGRID16169070 
FASALPS1A | APO-1 | APT1 | CD95 | FAS1 | FASTM | TNFRSF6Fas (TNF receptor superfamily, member 6)Two-hybridBioGRID16169070 
FXR1-fragile X mental retardation, autosomal homolog 1Two-hybridBioGRID16169070 
HMGB1DKFZp686A04236 | HMG1 | HMG3 | SBP-1high-mobility group box 1Two-hybridBioGRID16169070 
HNRNPH32H9 | FLJ34092 | HNRPH3heterogeneous nuclear ribonucleoprotein H3 (2H9)Two-hybridBioGRID16169070 
HNRNPUL1E1B-AP5 | E1BAP5 | FLJ12944 | HNRPUL1heterogeneous nuclear ribonucleoprotein U-like 1Two-hybridBioGRID16169070 
HSPE1CPN10 | GROES | HSP10heat shock 10kDa protein 1 (chaperonin 10)Two-hybridBioGRID16169070 
HYLS1FLJ32915 | HLShydrolethalus syndrome 1Two-hybridBioGRID16169070 
KLHL20KHLHX | KLEIP | KLHLX | RP3-383J4.3kelch-like 20 (Drosophila)Two-hybridBioGRID16169070 
LSM2C6orf28 | G7b | YBL026W | snRNPLSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)Two-hybridBioGRID16169070 
MPHOSPH6MPP | MPP-6 | MPP6M-phase phosphoprotein 6Two-hybridBioGRID16169070 
MRPL38HSPC262 | MGC4810 | MRP-L3 | RPML3mitochondrial ribosomal protein L38Two-hybridBioGRID16169070 
MRPS12MPR-S12 | MT-RPS12 | RPMS12 | RPS12 | RPSM12mitochondrial ribosomal protein S12Two-hybridBioGRID16169070 
NAT9DKFZp564C103 | EBSPN-acetyltransferase 9 (GCN5-related, putative)Two-hybridBioGRID16169070 
NDUFA4L2FLJ26118 | NUOMSNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2Two-hybridBioGRID16169070 
NSFSKD2N-ethylmaleimide-sensitive factorTwo-hybridBioGRID16169070 
PAFAH1B3-platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDaTwo-hybridBioGRID16169070 
PCDHA4CNR1 | CNRN1 | CRNR1 | MGC138307 | MGC142169 | PCDH-ALPHA4protocadherin alpha 4Two-hybridBioGRID16169070 
PFN1-profilin 1Two-hybridBioGRID16169070 
PHYHIPDYRK1AP3 | KIAA0273 | PAHX-AP | PAHXAP1phytanoyl-CoA 2-hydroxylase interacting proteinTwo-hybridBioGRID16169070 
POLE2DPE2polymerase (DNA directed), epsilon 2 (p59 subunit)Two-hybridBioGRID16169070 
POLR2CRPB3 | RPB31 | hRPB33 | hsRPB3polymerase (RNA) II (DNA directed) polypeptide C, 33kDaTwo-hybridBioGRID16169070 
POLR3FMGC13517 | RPC39 | RPC6polymerase (RNA) III (DNA directed) polypeptide F, 39 kDaTwo-hybridBioGRID16169070 
PPP1R8ARD-1 | ARD1 | NIPP-1 | NIPP1 | PRO2047protein phosphatase 1, regulatory (inhibitor) subunit 8Two-hybridBioGRID16169070 
PQBP1MRX55 | MRXS3 | MRXS8 | NPW38 | RENS1 | SHSpolyglutamine binding protein 1Two-hybridBioGRID16169070 
PXMP3PAF-1 | PAF1 | PEX2 | PMP3 | PMP35 | RNF72peroxisomal membrane protein 3, 35kDaTwo-hybridBioGRID16169070 
RAB27AGS2 | HsT18676 | MGC117246 | RAB27 | RAMRAB27A, member RAS oncogene familyTwo-hybridBioGRID16169070 
S100A860B8AG | CAGA | CFAG | CGLA | CP-10 | L1Ag | MA387 | MIF | MRP8 | NIF | P8S100 calcium binding protein A8Two-hybridBioGRID16169070 
SAT1DC21 | KFSD | SAT | SSAT | SSAT-1spermidine/spermine N1-acetyltransferase 1Two-hybridBioGRID16169070 
SEPHS1MGC4980 | SELD | SPS | SPS1selenophosphate synthetase 1Two-hybridBioGRID16169070 
SERPINB9CAP-3 | CAP3 | PI9serpin peptidase inhibitor, clade B (ovalbumin), member 9Two-hybridBioGRID16169070 
SNRPBCOD | SNRPB1 | SmB/SmB' | snRNP-Bsmall nuclear ribonucleoprotein polypeptides B and B1Two-hybridBioGRID16169070 
SNRPGMGC117317 | SMGsmall nuclear ribonucleoprotein polypeptide GTwo-hybridBioGRID16169070 
SULT1E1EST | EST-1 | MGC34459 | STEsulfotransferase family 1E, estrogen-preferring, member 1Two-hybridBioGRID16169070 
TFGFLJ36137 | TF6 | TRKT3TRK-fused geneTwo-hybridBioGRID16169070 
TK1TK2thymidine kinase 1, solubleTwo-hybridBioGRID16169070 
TNRC4BRUNOL1 | CAGH4 | CELF3 | ERDA4 | MGC57297trinucleotide repeat containing 4Two-hybridBioGRID16169070 
ZFP64MGC940 | ZNF338zinc finger protein 64 homolog (mouse)Two-hybridBioGRID16169070 
ZNF24KOX17 | RSG-A | ZNF191 | ZSCAN3 | Zfp191zinc finger protein 24Two-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-326398404m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.