Gene Page: WIF1

Summary
GeneID  11197
Symbol  WIF1
Synonyms  WIF-1
Description  WNT inhibitory factor 1
See related  HGNC:18081|MIM:605186|Ensembl:ENSG00000156076|HPRD:05541|
Locus tag  -
Gene type  protein-coding
Map location  12q14.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004713protein tyrosine kinase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016055Wnt receptor signaling pathwayIEA-
GO:0007165signal transductionNAS10201374 
GO:0007275multicellular organismal developmentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1376256321A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-144678684m8hsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-4902472531Ahsa-miR-490CAACCUGGAGGACUCCAUGCUG
miR-49545511Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.