Gene Page: STX1B

Summary
GeneID  112755
Symbol  STX1B
Synonyms  STX1B1|STX1B2
Description  syntaxin 1B
See related  HGNC:18539|MIM:601485|Ensembl:ENSG00000099365|HPRD:18126|
Locus tag  -
Gene type  protein-coding
Map location  16p11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 4 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005234extracellular-glutamate-gated ion channel activityTASglutamate (GO term level: 11)8105537 
GO:0005484SNAP receptor activityIEA-
GO:0005230extracellular ligand-gated ion channel activityTAS8105537 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007268synaptic transmissionIEAneuron, Synap, Neurotransmitter (GO term level: 6)-
GO:0007268synaptic transmissionTASneuron, Synap, Neurotransmitter (GO term level: 6)8105537 
GO:0006836neurotransmitter transportIEAneuron, Neurotransmitter (GO term level: 5)-
GO:0006886intracellular protein transportIEA-
GO:0016192vesicle-mediated transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0005887integral to plasma membraneTAS8105537 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
SNAP23HsT17016 | SNAP23A | SNAP23Bsynaptosomal-associated protein, 23kDaReconstituted ComplexBioGRID12651853 
STXBP1EIEE4 | MUNC18-1 | UNC18 | hUNC18 | rbSec1syntaxin binding protein 1Reconstituted ComplexBioGRID12093152 
UNC13BMGC133279 | MGC133280 | MUNC13 | UNC13 | Unc13h2 | hmunc13unc-13 homolog B (C. elegans)-HPRD,BioGRID8999968 
VAMP1DKFZp686H12131 | SYB1 | VAMP-1vesicle-associated membrane protein 1 (synaptobrevin 1)-HPRD,BioGRID12093152 
VAMP2FLJ11460 | SYB2 | VAMP-2vesicle-associated membrane protein 2 (synaptobrevin 2)-HPRD,BioGRID12093152 
VAMP8EDBvesicle-associated membrane protein 8 (endobrevin)-HPRD11112705 
VAPBALS8 | VAMP-B | VAMP-C | VAP-B | VAP-CVAMP (vesicle-associated membrane protein)-associated protein B and CReconstituted ComplexBioGRID12651853 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-13749551Ahsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-370198204m8hsa-miR-370brainGCCUGCUGGGGUGGAACCUGG
miR-455240246m8hsa-miR-455UAUGUGCCUUUGGACUACAUCG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.