|
|
| GeneID |
113189
|
| Symbol |
CHST14
|
| Synonyms |
D4ST-1|D4ST1|HD4ST|HNK1ST
|
| Description |
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 |
| See related |
HGNC:24464|Ensembl:ENSG00000169105|HPRD:16780| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
15q15.1 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| Expression | Expression | P value: 3.326 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0001537 | N-acetylgalactosamine 4-O-sulfotransferase activity | IDA | | 11470797 |
| GO:0005515 | protein binding | IEA | | - |
| GO:0016740 | transferase activity | IEA | | - |
| GO:0042301 | phosphate binding | NAS | | 11470797 |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005975 | carbohydrate metabolic process | IEA | | - |
| GO:0050655 | dermatan sulfate proteoglycan metabolic process | IDA | | 11470797 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0000139 | Golgi membrane | IEA | | - |
| GO:0005794 | Golgi apparatus | IEA | | - |
| GO:0016020 | membrane | IEA | | - |
| GO:0016021 | integral to membrane | NAS | | 11470797 |
| |
|
| miR-9 | 593 | 599 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|
