Gene Page: SLC35A4

Summary
GeneID  113829
Symbol  SLC35A4
Synonyms  MGC2541
Description  solute carrier family 35, member A4
See related  HGNC:20753|Ensembl:ENSG00000176087|HPRD:11574|
Locus tag  -
Gene type  protein-coding
Map location  5q31.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0032 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005351sugar:hydrogen symporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008643carbohydrate transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000139Golgi membraneIEA-
GO:0005794Golgi apparatusIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506105111m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-125/3516516581A,m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-1378979041A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-1436476541A,m8hsa-miR-143brainUGAGAUGAAGCACUGUAGCUCA
miR-4901401471A,m8hsa-miR-490CAACCUGGAGGACUCCAUGCUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.