Gene Page: GPRIN1

Summary
GeneID  114787
Symbol  GPRIN1
Synonyms  GRIN1|KIAA1893
Description  G protein regulated inducer of neurite outgrowth 1
See related  HGNC:24835|MIM:611239|Ensembl:ENSG00000169258|HPRD:11169|
Locus tag  -
Gene type  protein-coding
Map location  5q35.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.0276 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0042995cell projectionIEAaxon (GO term level: 4)-
GO:0005886plasma membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-542-3p9699761A,m8hsa-miR-542-3pUGUGACAGAUUGAUAACUGAAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.