Gene Page: C1QTNF5

Summary
GeneID  114902
Symbol  C1QTNF5
Synonyms  CTRP5|DKFZp586B0621|LORD
Description  C1q and tumor necrosis factor related protein 5
See related  HGNC:14344|MIM:608752|Ensembl:ENSG00000213192|HPRD:10575|
Locus tag  -
Gene type  protein-coding
Map location  11q23.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.006 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
C1QTNF5CTRP5 | DKFZp586B0621 | LORDC1q and tumor necrosis factor related protein 5-HPRD,BioGRID12944416 
MFRPC1QTNF5 | FLJ30570 | NNO2 | rd6membrane frizzled-related protein-HPRD12944416 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-5393543601Ahsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.