|
|
| GeneID |
115209
|
| Symbol |
OMA1
|
| Synonyms |
2010001O09Rik|DAB1|FLJ33782|MPRP-1|YKR087C|ZMPOMA1
|
| Description |
OMA1 homolog, zinc metallopeptidase (S. cerevisiae) |
| See related |
HGNC:29661|Ensembl:ENSG00000162600|HPRD:14879| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
1p32.1 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GSMA_IIA | genome scan meta-analysis (All samples) | Psr: 0.02692 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0004222 | metalloendopeptidase activity | IEA | | - |
| GO:0008270 | zinc ion binding | IEA | | - |
| GO:0008233 | peptidase activity | IEA | | - |
| GO:0046872 | metal ion binding | IEA | | - |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0006508 | proteolysis | IEA | | - |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005739 | mitochondrion | IEA | | - |
| GO:0016020 | membrane | IEA | | - |
| GO:0016021 | integral to membrane | IEA | | - |
| GO:0031966 | mitochondrial membrane | IEA | | - |
| |
|
| miR-433-3p | 161 | 167 | 1A | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|