Gene Page: SLC5A11

Summary
GeneID  115584
Symbol  SLC5A11
Synonyms  KST1|RKST1|SGLT6|SMIT2
Description  solute carrier family 5 (sodium/glucose cotransporter), member 11
See related  HGNC:23091|MIM:610238|Ensembl:ENSG00000158865|
Locus tag  -
Gene type  protein-coding
Map location  16pter-p11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005351sugar:hydrogen symporter activityIEA-
GO:0005215transporter activityIEA-
GO:0015293symporter activityIEA-
GO:0031402sodium ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008643carbohydrate transportIEA-
GO:0006814sodium ion transportIEA-
GO:0006811ion transportIEA-
GO:0006915apoptosisIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-30-5p8288m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.