Gene Page: ZMYND19

Summary
GeneID  116225
Symbol  ZMYND19
Synonyms  MIZIP|RP11-48C7.4
Description  zinc finger, MYND-type containing 19
See related  HGNC:21146|MIM:611424|Ensembl:ENSG00000165724|HPRD:15743|
Locus tag  -
Gene type  protein-coding
Map location  9q34.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0019717synaptosomeIEASynap, Brain (GO term level: 7)-
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
HACL12-HPCL | HPCL | HPCL2 | PHYH22-hydroxyacyl-CoA lyase 1Two-hybridBioGRID16189514 
KCTD13FKSG86 | PDIP1 | POLDIP1potassium channel tetramerisation domain containing 13Two-hybridBioGRID16189514 
LRRC68KIAA1986leucine rich repeat containing 68Two-hybridBioGRID16189514 
MCHR1GPR24 | MCH1R | MGC32129 | SLC1melanin-concentrating hormone receptor 1-HPRD12208518 
TNNT1ANM | FLJ98147 | MGC104241 | STNT | TNT | TNTStroponin T type 1 (skeletal, slow)Two-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-493-5p253259m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.