Gene Page: GRIN3A
Summary ?
GeneID | 116443 |
Symbol | GRIN3A |
Synonyms | GluN3A|NMDAR-L|NR3A |
Description | glutamate ionotropic receptor NMDA type subunit 3A |
Reference | MIM:606650|HGNC:HGNC:16767|Ensembl:ENSG00000198785|HPRD:09443|Vega:OTTHUMG00000020387 |
Gene type | protein-coding |
Map location | 9q31.1 |
Pascal p-value | 0.178 |
Sherlock p-value | 0.408 |
Fetal beta | -1.9 |
eGene | Meta |
Support | Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 8 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004972 | N-methyl-D-aspartate selective glutamate receptor activity | IDA | glutamate (GO term level: 8) | 17502428 |
GO:0004972 | N-methyl-D-aspartate selective glutamate receptor activity | ISS | glutamate (GO term level: 8) | - |
GO:0005234 | extracellular-glutamate-gated ion channel activity | IEA | glutamate (GO term level: 11) | - |
GO:0000287 | magnesium ion binding | IEA | - | |
GO:0004872 | receptor activity | IEA | - | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0005262 | calcium channel activity | IEA | - | |
GO:0005216 | ion channel activity | IEA | - | |
GO:0016594 | glycine binding | IDA | 17320117 | |
GO:0042802 | identical protein binding | IPI | 17997397 | |
GO:0051721 | protein phosphatase 2A binding | ISS | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016358 | dendrite development | IEA | neurite, dendrite (GO term level: 11) | - |
GO:0006816 | calcium ion transport | ISS | - | |
GO:0006811 | ion transport | IEA | - | |
GO:0045471 | response to ethanol | IDA | 17502428 |18445116 | |
GO:0060134 | prepulse inhibition | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0043025 | cell soma | IDA | axon, dendrite (GO term level: 4) | 17658481 |
GO:0043005 | neuron projection | IDA | neuron, axon, neurite, dendrite (GO term level: 5) | 17658481 |
GO:0017146 | N-methyl-D-aspartate selective glutamate receptor complex | IDA | glutamate, Synap (GO term level: 10) | 17997397 |
GO:0045211 | postsynaptic membrane | IEA | Synap, Neurotransmitter (GO term level: 5) | - |
GO:0045202 | synapse | IDA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | 17658481 |
GO:0016021 | integral to membrane | NAS | 11880201 | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-10 | 190 | 196 | 1A | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
hsa-miR-10b | UACCCUGUAGAACCGAAUUUGU | ||||
miR-124/506 | 817 | 823 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-141/200a | 2716 | 2722 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-186 | 2324 | 2330 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-33 | 2354 | 2360 | 1A | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
miR-370 | 2568 | 2574 | m8 | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
miR-421 | 2434 | 2440 | 1A | hsa-miR-421 | GGCCUCAUUAAAUGUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.