Gene Page: C1orf182

Summary
GeneID  128229
Symbol  C1orf182
Synonyms  MGC26877|RP11-443G18.5|SSTK-IP
Description  chromosome 1 open reading frame 182
See related  HGNC:30636|Ensembl:ENSG00000163467|HPRD:10252|
Locus tag  -
Gene type  protein-coding
Map location  1q22
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DTNBMGC17163 | MGC57126dystrobrevin, betaTwo-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3757131Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.