|
|
| GeneID |
129049
|
| Symbol |
SGSM1
|
| Synonyms |
KIAA1941|MGC133298|RUTBC2
|
| Description |
small G protein signaling modulator 1 |
| See related |
HGNC:29410|MIM:611417| |
| Locus tag |
RP5-930L11.1 |
| Gene type |
protein-coding |
| Map location |
22q11.23 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GSMA_I | genome scan meta-analysis | Psr: 0.031 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005097 | Rab GTPase activator activity | IEA | | - |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0032313 | regulation of Rab GTPase activity | IEA | | - |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005794 | Golgi apparatus | IEA | | - |
| GO:0005622 | intracellular | IEA | | - |
| |
|
|
| miR-9 | 216 | 223 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|