Gene Page: SGSM1

Summary
GeneID  129049
Symbol  SGSM1
Synonyms  KIAA1941|MGC133298|RUTBC2
Description  small G protein signaling modulator 1
See related  HGNC:29410|MIM:611417|
Locus tag  RP5-930L11.1
Gene type  protein-coding
Map location  22q11.23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.031 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005097Rab GTPase activator activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0032313regulation of Rab GTPase activityIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005794Golgi apparatusIEA-
GO:0005622intracellularIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-92162231A,m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.