Gene Page: COL10A1

Summary
GeneID  1300
Symbol  COL10A1
Synonyms  -
Description  collagen, type X, alpha 1
See related  HGNC:2185|MIM:120110|Ensembl:ENSG00000123500|HPRD:00357|
Locus tag  -
Gene type  protein-coding
Map location  6q21-q22
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005509calcium ion bindingIEA-
GO:0005198structural molecule activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001501skeletal system developmentTAS8554571 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005581collagenTAS8554571 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ANXA5ANX5 | ENX2 | PP4annexin A5-HPRD,BioGRID1397263 
COL10A1-collagen, type X, alpha 1-HPRD,BioGRID11805116 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1019369431A,m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-1449379431Ahsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-264694761A,m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.