Gene Page: NACC2

Summary
GeneID  138151
Symbol  NACC2
Synonyms  BEND9|BTBD14|BTBD14A|MGC23427
Description  NACC family member 2, BEN and BTB (POZ) domain containing
See related  HGNC:23846|Ensembl:ENSG00000148411|HPRD:09831|
Locus tag  -
Gene type  protein-coding
Map location  9q34.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.65 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-205151157m8hsa-miR-205UCCUUCAUUCCACCGGAGUCUG
miR-236874m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-32368741Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
hsa-miR-323brainGCACAUUACACGGUCGACCUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.