Gene Page: CRH
Summary ?
GeneID | 1392 |
Symbol | CRH |
Synonyms | CRF|CRH1 |
Description | corticotropin releasing hormone |
Reference | MIM:122560|HGNC:HGNC:2355|Ensembl:ENSG00000147571|HPRD:07172|Vega:OTTHUMG00000164474 |
Gene type | protein-coding |
Map location | 8q13 |
Pascal p-value | 0.153 |
Fetal beta | -3.183 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | NEUROTROPHIN SIGNALING |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Expression | Meta-analysis of gene expression | P value: 1.491 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias,schizotypal | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg08215831 | 8 | 67090776 | CRH | 1.914E-4 | -0.412 | 0.035 | DMG:Wockner_2014 |
cg19035496 | 8 | 67090792 | CRH | 2.024E-4 | -0.357 | 0.035 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs595174 | chr18 | 23542566 | CRH | 1392 | 0.08 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005184 | neuropeptide hormone activity | TAS | axon, Synap, Brain, Neurotransmitter (GO term level: 6) | 7867564 |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 7477348 |
GO:0007165 | signal transduction | TAS | 7867564 | |
GO:0007611 | learning or memory | TAS | 7477348 | |
GO:0007567 | parturition | TAS | 7585095 | |
GO:0007565 | female pregnancy | TAS | 7585095 | |
GO:0006704 | glucocorticoid biosynthetic process | IEA | - | |
GO:0006954 | inflammatory response | IEA | - | |
GO:0030325 | adrenal gland development | IEA | - | |
GO:0030324 | lung development | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0005625 | soluble fraction | TAS | 7477348 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG LONG TERM DEPRESSION | 70 | 53 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS | 88 | 58 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA S SIGNALLING EVENTS | 121 | 82 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
LI AMPLIFIED IN LUNG CANCER | 178 | 108 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
CHANG IMMORTALIZED BY HPV31 UP | 84 | 55 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN | 165 | 106 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-200bc/429 | 59 | 65 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.