Gene Page: VTI1A
Summary ?
| GeneID | 143187 |
| Symbol | VTI1A |
| Synonyms | MMDS3|MVti1|VTI1RP2|Vti1-rp2 |
| Description | vesicle transport through interaction with t-SNAREs 1A |
| Reference | MIM:614316|HGNC:HGNC:17792|Ensembl:ENSG00000151532|HPRD:18290|Vega:OTTHUMG00000019063 |
| Gene type | protein-coding |
| Map location | 10q25.2 |
| Pascal p-value | 0.082 |
| Fetal beta | 0.233 |
| DMG | 1 (# studies) |
| Support | INTRACELLULAR TRAFFICKING |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg03530074 | 10 | 114536223 | VTI1A | 4.57E-5 | -0.652 | 0.021 | DMG:Wockner_2014 |
| cg18903373 | 10 | 114469566 | VTI1A | 2.104E-4 | 0.282 | 0.035 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005484 | SNAP receptor activity | IDA | 15215310 | |
| GO:0008565 | protein transporter activity | NAS | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006886 | intracellular protein transport | IEA | - | |
| GO:0016192 | vesicle-mediated transport | NAS | - | |
| GO:0042147 | retrograde transport, endosome to Golgi | IDA | 15215310 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0031201 | SNARE complex | TAS | neuron, Synap (GO term level: 6) | 15215310 |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG SNARE INTERACTIONS IN VESICULAR TRANSPORT | 38 | 25 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE DN | 244 | 147 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
| KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
| ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
| FONTAINE PAPILLARY THYROID CARCINOMA UP | 66 | 38 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-137 | 2598 | 2604 | m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
| miR-15/16/195/424/497 | 3145 | 3151 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-155 | 3337 | 3343 | 1A | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-186 | 3089 | 3095 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-19 | 3077 | 3084 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-200bc/429 | 3113 | 3119 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
| miR-203.1 | 3108 | 3114 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
| miR-214 | 3143 | 3149 | m8 | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
| miR-223 | 3190 | 3196 | 1A | hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC |
| miR-24 | 2794 | 2800 | m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
| miR-326 | 3206 | 3212 | m8 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
| miR-330 | 2778 | 2784 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
| miR-375 | 2829 | 2835 | 1A | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.