Gene Page: ZNF828

Summary
GeneID  283489
Symbol  ZNF828
Synonyms  C13orf8|FLJ90413|KIAA1802
Description  zinc finger protein 828
See related  HGNC:20311|Ensembl:ENSG00000198824|HPRD:10707|
Locus tag  -
Gene type  protein-coding
Map location  13q34
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.658 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusIDA18029348 
GO:0005730nucleolusIDA18029348 
GO:0005737cytoplasmIDA18029348 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-78668731A,m8hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.