Gene Page: CTLA4
Summary ?
| GeneID | 1493 |
| Symbol | CTLA4 |
| Synonyms | ALPS5|CD|CD152|CELIAC3|CTLA-4|GRD4|GSE|IDDM12 |
| Description | cytotoxic T-lymphocyte associated protein 4 |
| Reference | MIM:123890|HGNC:HGNC:2505|Ensembl:ENSG00000163599|HPRD:00474|Vega:OTTHUMG00000132877 |
| Gene type | protein-coding |
| Map location | 2q33 |
| Pascal p-value | 0.24 |
| Fetal beta | -0.343 |
| eGene | Nucleus accumbens basal ganglia Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs959032 | chr2 | 205316038 | CTLA4 | 1493 | 0.14 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0006955 | immune response | IEA | - | |
| GO:0006955 | immune response | TAS | 3220103 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | TAS | 3220103 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| AP1M1 | AP47 | CLAPM2 | CLTNM | MU-1A | adaptor-related protein complex 1, mu 1 subunit | - | HPRD,BioGRID | 9812899 |11583591 |
| AP2M1 | AP50 | CLAPM1 | mu2 | adaptor-related protein complex 2, mu 1 subunit | Affinity Capture-Western Co-crystal Structure Reconstituted Complex Two-hybrid | BioGRID | 9200449 |11583591 |
| AP2M1 | AP50 | CLAPM1 | mu2 | adaptor-related protein complex 2, mu 1 subunit | - | HPRD | 9200449 |9256472 |11583591|9256472 |
| CD80 | CD28LG | CD28LG1 | LAB7 | CD80 molecule | - | HPRD,BioGRID | 7545666 |
| CD80 | CD28LG | CD28LG1 | LAB7 | CD80 molecule | CD80 interacts with CTLA-4. | BIND | 15610849 |
| CD86 | B7-2 | B70 | CD28LG2 | LAB72 | MGC34413 | CD86 molecule | - | HPRD,BioGRID | 11021528 |11279501 |
| CTLA4 | CD152 | CELIAC3 | CTLA-4 | GSE | IDDM12 | cytotoxic T-lymphocyte-associated protein 4 | Co-crystal Structure | BioGRID | 11279502 |
| FYN | MGC45350 | SLK | SYN | FYN oncogene related to SRC, FGR, YES | - | HPRD,BioGRID | 9712716 |
| JAK2 | JTK10 | Janus kinase 2 (a protein tyrosine kinase) | CTLA-4 interacts with Jak2. | BIND | 10842319 |
| JAK2 | JTK10 | Janus kinase 2 (a protein tyrosine kinase) | - | HPRD,BioGRID | 10842319 |
| LCK | YT16 | p56lck | pp58lck | lymphocyte-specific protein tyrosine kinase | - | HPRD,BioGRID | 9712716 |
| LYN | FLJ26625 | JTK8 | v-yes-1 Yamaguchi sarcoma viral related oncogene homolog | - | HPRD,BioGRID | 9712716 |
| PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | - | HPRD | 7807015 |
| PPP2R5A | B56A | MGC131915 | PR61A | protein phosphatase 2, regulatory subunit B', alpha isoform | - | HPRD,BioGRID | 11994459 |
| PTPN11 | BPTP3 | CFC | MGC14433 | NS1 | PTP-1D | PTP2C | SH-PTP2 | SH-PTP3 | SHP2 | protein tyrosine phosphatase, non-receptor type 11 | - | HPRD,BioGRID | 8638161 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CELL ADHESION MOLECULES CAMS | 134 | 93 | All SZGR 2.0 genes in this pathway |
| KEGG T CELL RECEPTOR SIGNALING PATHWAY | 108 | 89 | All SZGR 2.0 genes in this pathway |
| KEGG AUTOIMMUNE THYROID DISEASE | 53 | 49 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CTLA4 PATHWAY | 21 | 18 | All SZGR 2.0 genes in this pathway |
| ST T CELL SIGNAL TRANSDUCTION | 45 | 33 | All SZGR 2.0 genes in this pathway |
| PID NFAT TFPATHWAY | 47 | 39 | All SZGR 2.0 genes in this pathway |
| REACTOME COSTIMULATION BY THE CD28 FAMILY | 63 | 48 | All SZGR 2.0 genes in this pathway |
| REACTOME CTLA4 INHIBITORY SIGNALING | 21 | 15 | All SZGR 2.0 genes in this pathway |
| REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
| REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
| DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
| TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
| MA MYELOID DIFFERENTIATION DN | 44 | 30 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER T4 | 94 | 69 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER P4 | 100 | 62 | All SZGR 2.0 genes in this pathway |
| GAVIN PDE3B TARGETS | 22 | 15 | All SZGR 2.0 genes in this pathway |
| ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
| ZHENG FOXP3 TARGETS UP | 26 | 16 | All SZGR 2.0 genes in this pathway |
| KONDO PROSTATE CANCER WITH H3K27ME3 | 196 | 93 | All SZGR 2.0 genes in this pathway |
| VILIMAS NOTCH1 TARGETS UP | 52 | 41 | All SZGR 2.0 genes in this pathway |
| GOLDRATH ANTIGEN RESPONSE | 346 | 192 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
| SENGUPTA EBNA1 ANTICORRELATED | 173 | 85 | All SZGR 2.0 genes in this pathway |
| LI INDUCED T TO NATURAL KILLER DN | 116 | 83 | All SZGR 2.0 genes in this pathway |
| BOSCO TH1 CYTOTOXIC MODULE | 114 | 62 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-155 | 260 | 266 | m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-33 | 1094 | 1100 | 1A | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
| hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
| miR-421 | 47 | 53 | 1A | hsa-miR-421 | GGCCUCAUUAAAUGUUUGUUG |
| miR-9 | 306 | 312 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.