Gene Page: CTNNA1
Summary ?
GeneID | 1495 |
Symbol | CTNNA1 |
Synonyms | CAP102 |
Description | catenin alpha 1 |
Reference | MIM:116805|HGNC:HGNC:2509|Ensembl:ENSG00000044115|HPRD:00285|Vega:OTTHUMG00000163502 |
Gene type | protein-coding |
Map location | 5q31.2 |
Pascal p-value | 0.586 |
Sherlock p-value | 0.88 |
Fetal beta | 0.146 |
DMG | 1 (# studies) |
eGene | Caudate basal ganglia Cerebellar Hemisphere Cerebellum Frontal Cortex BA9 |
Support | INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg01873236 | 5 | 138088662 | CTNNA1 | 2.563E-4 | -0.406 | 0.038 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ADAMTS10 | 0.88 | 0.79 |
CNKSR1 | 0.88 | 0.80 |
LPAR2 | 0.88 | 0.76 |
HGFAC | 0.88 | 0.78 |
MAMDC4 | 0.88 | 0.77 |
VWCE | 0.87 | 0.78 |
ATAD3B | 0.87 | 0.78 |
JMJD7-PLA2G4B | 0.87 | 0.80 |
MICAL1 | 0.87 | 0.80 |
CCDC57 | 0.86 | 0.76 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ABCG2 | -0.54 | -0.58 |
ITM2B | -0.53 | -0.56 |
ACOT13 | -0.52 | -0.57 |
PLA2G4A | -0.52 | -0.59 |
AF347015.31 | -0.51 | -0.61 |
AF347015.27 | -0.51 | -0.61 |
FAM162A | -0.51 | -0.55 |
C5orf53 | -0.50 | -0.55 |
HLA-C | -0.50 | -0.47 |
ALDOC | -0.50 | -0.49 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 12477722 | |
GO:0005198 | structural molecule activity | IEA | - | |
GO:0051015 | actin filament binding | IEA | - | |
GO:0017166 | vinculin binding | IPI | 9700171 | |
GO:0045296 | cadherin binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007406 | negative regulation of neuroblast proliferation | IEA | neurogenesis (GO term level: 10) | - |
GO:0007155 | cell adhesion | NAS | 8323564 | |
GO:0007163 | establishment or maintenance of cell polarity | IEA | - | |
GO:0043066 | negative regulation of apoptosis | IEA | - | |
GO:0043297 | apical junction assembly | NAS | 9700171 | |
GO:0045880 | positive regulation of smoothened signaling pathway | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - | |
GO:0030027 | lamellipodium | IEA | - | |
GO:0005915 | zonula adherens | IEA | - | |
GO:0005912 | adherens junction | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0015629 | actin cytoskeleton | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ACTN1 | FLJ40884 | actinin, alpha 1 | - | HPRD,BioGRID | 7790378 |
APC | BTPS2 | DP2 | DP2.5 | DP3 | GS | adenomatous polyposis coli | Affinity Capture-Western | BioGRID | 7651399 |8259519 |
CA9 | CAIX | MN | carbonic anhydrase IX | Affinity Capture-Western | BioGRID | 14567991 |
CDH1 | Arc-1 | CD324 | CDHE | ECAD | LCAM | UVO | cadherin 1, type 1, E-cadherin (epithelial) | Affinity Capture-Western | BioGRID | 7542250 |8227214 |9233779 |10381631 |11960376 |
CDH2 | CD325 | CDHN | CDw325 | NCAD | cadherin 2, type 1, N-cadherin (neuronal) | Affinity Capture-MS Affinity Capture-Western | BioGRID | 12604612 |14625392 |
CDH3 | CDHP | HJMD | PCAD | cadherin 3, type 1, P-cadherin (placental) | Affinity Capture-Western Co-purification | BioGRID | 10381631 |10910767 |
CDH5 | 7B4 | CD144 | FLJ17376 | cadherin 5, type 2 (vascular endothelium) | - | HPRD,BioGRID | 12003790 |
CTNNA1 | CAP102 | FLJ36832 | catenin (cadherin-associated protein), alpha 1, 102kDa | Affinity Capture-Western | BioGRID | 9762469 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | - | HPRD,BioGRID | 7706414 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | Beta-catenin interacts with alpha-catenin. This interaction was modelled on a demonstrated interaction between human beta-catenin and mouse alpha-catenin. | BIND | 15294866 |
CTNND1 | CAS | CTNND | KIAA0384 | P120CAS | P120CTN | p120 | catenin (cadherin-associated protein), delta 1 | Affinity Capture-Western | BioGRID | 7651399 |
DLG1 | DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlg | discs, large homolog 1 (Drosophila) | - | HPRD,BioGRID | 9512503 |
FAM84B | BCMP101 | NSE2 | family with sequence similarity 84, member B | - | HPRD,BioGRID | 12477722 |
JUB | Ajuba | MGC15563 | jub, ajuba homolog (Xenopus laevis) | - | HPRD | 12417594 |
JUP | ARVD12 | CTNNG | DP3 | DPIII | PDGB | PKGB | junction plakoglobin | - | HPRD,BioGRID | 7650039 |9110993 |
MLLT4 | AF-6 | AF6 | AFADIN | FLJ34371 | RP3-431P23.3 | myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 | - | HPRD,BioGRID | 11907041 |
MYO7A | DFNA11 | DFNB2 | MYOVIIA | MYU7A | NSRD2 | USH1B | myosin VIIA | Affinity Capture-Western | BioGRID | 11080149 |
PSEN1 | AD3 | FAD | PS1 | S182 | presenilin 1 | Affinity Capture-Western | BioGRID | 10635315 |
PTPN14 | MGC126803 | PEZ | PTP36 | protein tyrosine phosphatase, non-receptor type 14 | Affinity Capture-MS | BioGRID | 12808048 |
SPTAN1 | (ALPHA)II-SPECTRIN | FLJ44613 | NEAS | spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) | - | HPRD | 11069925 |
SPTBN1 | ELF | SPTB2 | betaSpII | spectrin, beta, non-erythrocytic 1 | Reconstituted Complex | BioGRID | 11069925 |
TJP2 | MGC26306 | X104 | ZO-2 | ZO2 | tight junction protein 2 (zona occludens 2) | - | HPRD,BioGRID | 10026224 |
VCL | CMD1W | MVCL | vinculin | - | HPRD,BioGRID | 9700171 |
VEZT | DKFZp761C241 | VEZATIN | vezatin, adherens junctions transmembrane protein | - | HPRD,BioGRID | 11080149 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ADHERENS JUNCTION | 75 | 53 | All SZGR 2.0 genes in this pathway |
KEGG TIGHT JUNCTION | 134 | 86 | All SZGR 2.0 genes in this pathway |
KEGG LEUKOCYTE TRANSENDOTHELIAL MIGRATION | 118 | 78 | All SZGR 2.0 genes in this pathway |
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG ENDOMETRIAL CANCER | 52 | 45 | All SZGR 2.0 genes in this pathway |
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC | 76 | 59 | All SZGR 2.0 genes in this pathway |
BIOCARTA CELL2CELL PATHWAY | 14 | 11 | All SZGR 2.0 genes in this pathway |
PID MET PATHWAY | 80 | 60 | All SZGR 2.0 genes in this pathway |
PID ARF6 TRAFFICKING PATHWAY | 49 | 34 | All SZGR 2.0 genes in this pathway |
PID NECTIN PATHWAY | 30 | 20 | All SZGR 2.0 genes in this pathway |
PID CDC42 PATHWAY | 70 | 51 | All SZGR 2.0 genes in this pathway |
PID AJDISS 2PATHWAY | 48 | 38 | All SZGR 2.0 genes in this pathway |
PID ECADHERIN NASCENT AJ PATHWAY | 39 | 33 | All SZGR 2.0 genes in this pathway |
PID ECADHERIN KERATINOCYTE PATHWAY | 21 | 19 | All SZGR 2.0 genes in this pathway |
PID ECADHERIN STABILIZATION PATHWAY | 42 | 34 | All SZGR 2.0 genes in this pathway |
PID VEGFR1 2 PATHWAY | 69 | 57 | All SZGR 2.0 genes in this pathway |
PID NCADHERIN PATHWAY | 33 | 32 | All SZGR 2.0 genes in this pathway |
PID RAC1 PATHWAY | 54 | 37 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CELL COMMUNICATION | 120 | 77 | All SZGR 2.0 genes in this pathway |
REACTOME ADHERENS JUNCTIONS INTERACTIONS | 27 | 20 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CELL JUNCTION ORGANIZATION | 56 | 31 | All SZGR 2.0 genes in this pathway |
REACTOME CELL JUNCTION ORGANIZATION | 78 | 43 | All SZGR 2.0 genes in this pathway |
REACTOME MYOGENESIS | 28 | 20 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 DN | 267 | 178 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP | 368 | 234 | All SZGR 2.0 genes in this pathway |
WANG CLIM2 TARGETS UP | 269 | 146 | All SZGR 2.0 genes in this pathway |
AKL HTLV1 INFECTION UP | 27 | 16 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR DN | 209 | 122 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
OUELLET OVARIAN CANCER INVASIVE VS LMP UP | 117 | 85 | All SZGR 2.0 genes in this pathway |
BARIS THYROID CANCER DN | 59 | 45 | All SZGR 2.0 genes in this pathway |
WANG METHYLATED IN BREAST CANCER | 35 | 25 | All SZGR 2.0 genes in this pathway |
KIM MYC AMPLIFICATION TARGETS DN | 97 | 51 | All SZGR 2.0 genes in this pathway |
FALVELLA SMOKERS WITH LUNG CANCER | 80 | 52 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
BASSO B LYMPHOCYTE NETWORK | 143 | 96 | All SZGR 2.0 genes in this pathway |
IIZUKA LIVER CANCER PROGRESSION L0 L1 DN | 21 | 14 | All SZGR 2.0 genes in this pathway |
PENG GLUCOSE DEPRIVATION DN | 169 | 112 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
ALCALAY AML BY NPM1 LOCALIZATION UP | 140 | 83 | All SZGR 2.0 genes in this pathway |
FAELT B CLL WITH VH3 21 DN | 49 | 29 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C8 | 72 | 56 | All SZGR 2.0 genes in this pathway |
WEIGEL OXIDATIVE STRESS BY TBH AND H2O2 | 36 | 24 | All SZGR 2.0 genes in this pathway |
KAAB FAILED HEART ATRIUM DN | 141 | 99 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION MUSCLE UP | 43 | 33 | All SZGR 2.0 genes in this pathway |
VERRECCHIA RESPONSE TO TGFB1 C5 | 21 | 11 | All SZGR 2.0 genes in this pathway |
VERRECCHIA DELAYED RESPONSE TO TGFB1 | 39 | 26 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION NEOCORTEX DN | 88 | 58 | All SZGR 2.0 genes in this pathway |
HEDENFALK BREAST CANCER BRCA1 VS BRCA2 | 163 | 113 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN DN | 249 | 165 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D CLUSTER DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D DN | 78 | 34 | All SZGR 2.0 genes in this pathway |
GOLDRATH ANTIGEN RESPONSE | 346 | 192 | All SZGR 2.0 genes in this pathway |
LINDSTEDT DENDRITIC CELL MATURATION C | 69 | 49 | All SZGR 2.0 genes in this pathway |
RAY TARGETS OF P210 BCR ABL FUSION UP | 18 | 13 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 4 | 31 | 17 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 15 | 31 | 19 | All SZGR 2.0 genes in this pathway |
VALK AML WITH CEBPA | 37 | 27 | All SZGR 2.0 genes in this pathway |
FONTAINE THYROID TUMOR UNCERTAIN MALIGNANCY UP | 36 | 23 | All SZGR 2.0 genes in this pathway |
FONTAINE PAPILLARY THYROID CARCINOMA UP | 66 | 38 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA PCA3 DN | 69 | 38 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
WHITFIELD CELL CYCLE G2 M | 216 | 124 | All SZGR 2.0 genes in this pathway |
LI INDUCED T TO NATURAL KILLER UP | 307 | 182 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-141/200a | 717 | 723 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.