Gene Page: ADRA2B
Summary ?
GeneID | 151 |
Symbol | ADRA2B |
Synonyms | ADRA2L1|ADRA2RL1|ADRARL1|ALPHA2BAR|FAME2|alpha-2BAR |
Description | adrenoceptor alpha 2B |
Reference | MIM:104260|HGNC:HGNC:282|Ensembl:ENSG00000274286|HPRD:00086|Vega:OTTHUMG00000188276 |
Gene type | protein-coding |
Map location | 2q11.1 |
Pascal p-value | 0.042 |
Fetal beta | -0.347 |
eGene | Cerebellar Hemisphere Cerebellum Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
ADT:Sun_2012 | Systematic Investigation of Antipsychotic Drugs and Their Targets | A total of 382 drug-target associations involving 43 antipsychotic drugs and 49 target genes. | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0004 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10958910 | chr9 | 10134759 | ADRA2B | 151 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
UNC93B3 | 0.68 | 0.68 |
CXCL16 | 0.66 | 0.71 |
PARP12 | 0.64 | 0.68 |
TNFRSF1A | 0.64 | 0.68 |
SLC15A3 | 0.63 | 0.69 |
HLA-E | 0.62 | 0.68 |
LGALS9 | 0.61 | 0.69 |
BAMBI | 0.60 | 0.64 |
FAH | 0.60 | 0.65 |
IRF1 | 0.60 | 0.65 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RTF1 | -0.51 | -0.54 |
SRPK1 | -0.49 | -0.51 |
ANKRD12 | -0.49 | -0.55 |
TMEM57 | -0.48 | -0.49 |
ZNF714 | -0.48 | -0.51 |
MPP3 | -0.48 | -0.50 |
KIDINS220 | -0.48 | -0.47 |
STMN1 | -0.48 | -0.53 |
BZW2 | -0.48 | -0.53 |
ZNF91 | -0.48 | -0.51 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004872 | receptor activity | IEA | - | |
GO:0004938 | alpha2-adrenergic receptor activity | TAS | 2164221 | |
GO:0004935 | adrenoceptor activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007186 | G-protein coupled receptor protein signaling pathway | TAS | 2164221 | |
GO:0007267 | cell-cell signaling | TAS | 2164221 | |
GO:0007165 | signal transduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005886 | plasma membrane | TAS | 2164221 | |
GO:0005887 | integral to plasma membrane | TAS | 2164221 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS | 305 | 177 | All SZGR 2.0 genes in this pathway |
REACTOME AMINE LIGAND BINDING RECEPTORS | 38 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA I SIGNALLING EVENTS | 195 | 114 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA Z SIGNALLING EVENTS | 44 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET AGGREGATION PLUG FORMATION | 36 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION | 208 | 138 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 DN | 153 | 100 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS DN | 357 | 212 | All SZGR 2.0 genes in this pathway |
CHESLER BRAIN D6MIT150 QTL TRANS | 9 | 7 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER LATE RECURRENCE DN | 69 | 48 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SURVIVAL DN | 113 | 76 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-139 | 914 | 920 | 1A | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
miR-23 | 854 | 860 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-30-5p | 893 | 899 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-323 | 854 | 860 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-329 | 939 | 945 | m8 | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
miR-330 | 816 | 822 | 1A | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
miR-377 | 941 | 948 | 1A,m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.