Gene Page: UPP2

Summary
GeneID  151531
Symbol  UPP2
Synonyms  UDRPASE2|UP2|UPASE2
Description  uridine phosphorylase 2
See related  HGNC:23061|Ensembl:ENSG00000007001|HPRD:15627|
Locus tag  -
Gene type  protein-coding
Map location  2q24.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.02395 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIDA11278417 
GO:0004850uridine phosphorylase activityIDA12849978 
GO:0016757transferase activity, transferring glycosyl groupsIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0009116nucleoside metabolic processNAS12849978 
GO:0009166nucleotide catabolic processIEA-
GO:0046108uridine metabolic processNAS11278417 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0045098type III intermediate filamentIDAGlial (GO term level: 11)11278417 
GO:0005829cytosolNAS11278417 
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
VIMFLJ36605vimentin-HPRD,BioGRID11278417 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1552762831A,m8hsa-miR-155UUAAUGCUAAUCGUGAUAGGGG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.