Gene Page: MOSPD2

Summary
GeneID  158747
Symbol  MOSPD2
Synonyms  MGC26706
Description  motile sperm domain containing 2
See related  HGNC:28381|Ensembl:ENSG00000130150|HPRD:06642|
Locus tag  -
Gene type  protein-coding
Map location  Xp22.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.804 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005198structural molecule activityIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005783endoplasmic reticulumIDA18029348 
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIDA18029348 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1825735791Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-30-3p3353421A,m8hsa-miR-30a-3pCUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3pCUUUCAGUCGGAUGUUUACAGC
miR-376c4374431Ahsa-miR-376cAACAUAGAGGAAAUUCCACG
miR-4965575631Ahsa-miR-496AUUACAUGGCCAAUCUC
miR-965735791Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.